We narrowed to 44,705 results for: cha;
-
Plasmid#104054PurposeAn AAV genome encoding expression of the nuclear localized fluorescent protein tdTomato from the MBP promoterDepositorInsert2xNLS-tdTomato
UseAAVTagsNLSPromoterMBPAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-NLS-GFP
Plasmid#104061PurposeAAV expression of nuclear localized GFP with SV40 NLSDepositorHas ServiceAAV PHP.eBInsertGFP
UseAAVPromoterCAGAvailable SinceAug. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-EYFP
Plasmid#104052PurposeAn AAV genome encoding Cre-dependent expression of the fluorescent protein EYFP from the CAG promoterDepositorHas ServiceAAV PHP.V1InsertEYFP
UseAAVPromoterCAGAvailable SinceJan. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP
Plasmid#104055PurposeAn AAV genome that ubiquitously expresses the fluorescent protein eYFP from the CAG promoterDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV2, and AAV5InsertEYFP
UseAAVPromoterCAGAvailable SinceJan. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
Cut190*_pET21b
Plasmid#215404PurposeExpression construct for Cut190* gene, codon optimized for expression in E. coliDepositorInsertCut190*
ExpressionBacterialMutationS226P/R228SAvailable SinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCG150_double_phiC31_attB
Plasmid#169693Purposecargo vector for the phiC31 system with, unc-119 rescue fragment, no fluorescent marker. Gateway R3R4 sites (for gene of interest insertion)DepositorTypeEmpty backboneExpressionWormAvailable SinceOct. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eYFP
Plasmid#117383PurposeAn AAV genome with tet-inducible, Cre-dependent expression of the fluorescent protein eYFPDepositorHas ServiceAAV1InsertEYFP
UseAAVExpressionMammalianPromoterTREAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-2xNLS-mTurquoise2
Plasmid#118025PurposeAn AAV genome that expresses nuclear localized mTurquoise2 from the hSyn1 promoterDepositorInsert2xNLS-mTurquoise2
UseAAVTagsNLSPromoterhSyn1Available SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-2xNLS-mTurquoise2
Plasmid#104053PurposeAn AAV genome encoding expression of the nuclear localized fluorescent protein mTurquoise2 from the GFAP promoterDepositorInsert2xNLS-mTurquoise2
UseAAVTagsNLSPromoterGFAPAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eYFP-f
Plasmid#104057PurposeAn AAV genome with tet-inducible, Cre-dependent expression of the fluorescent protein eYFP with a C-terminal Hras farnesylation sequenceDepositorInsertEYFP-f
UseAAVPromoterTREAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a(+)-HisTim12_CtoA
Plasmid#170281PurposeExpresses yeast Tim12 (the latter with cleavable N-ter His-tag), codon-optimized for E. coli productionDepositorInsertyeast Tim12 (TIM12 Budding Yeast)
TagsTEV-cleavable N-terminal His tag (on backbone)ExpressionBacterialMutationmutated two non-conserved Cys to AlaAvailable SinceJune 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1+_hsTRPA1_myc_dTom
Plasmid#183179Purposemyc tagged hsTRPA1 used for cell transfectionDepositorInsertsExpressionMammalianAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-eYFP
Plasmid#117382PurposeAn AAV genome that expresses the fluorescent protein eYFP from the hSyn1 promoterDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InsertEYFP
UseAAVExpressionMammalianPromoterhSyn1Available SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV_OHu19986C_myc tag
Plasmid#183174Purposeused to make AAV vectors for hsTRPA1 tagged with mycDepositorAvailable SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 Lats1 (Nigg HS189)
Plasmid#41156DepositorAvailable SinceJune 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pECNUS4
Plasmid#184887PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterRPS5AAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-1 TIM8,13
Plasmid#170282PurposeExpresses both yeast Tim8 and yeast Tim13 (the latter with cleavable N-ter His-tag), codon-optimized for E. coli productionDepositorInsertyeast Tim8 and Tim13 (TIM8 Budding Yeast)
TagsTEV-cleavable N-terminal His tag on Tim13 (on bac…ExpressionBacterialAvailable SinceJune 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pECNUS4_MP
Plasmid#228358PurposeABE8e-SpCas9-NG Multiplex Acceptor clone for insertion of up to six gRNA cassettes via Golden Gate with BpiI and T4 ligase, blue-white screeningDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterRPS5AAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only