We narrowed to 1,690 results for: Tyr
-
Plasmid#166975PurposeExpresses FBF-2 with AQ/Y mutations in repeat 5 in E. coli for purification and crystallization studiesDepositorInsertFBF-2 (fbf-2 Nematode)
TagsHis-SUMOExpressionBacterialMutationFBF-2 PUM RNA binding domain; amino acids 164-575…PromoterT7Available SinceApril 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3508 (YCp LEU2 Rpb1 Y1473A)
Plasmid#91811PurposeYeast expression of S. cerevisiae Rpb1 with a Y1473A mutationDepositorInsertRPO21 (RPO21 Budding Yeast)
ExpressionYeastMutationchanged tyrosine 1473 to alaninePromoterEndogenous Rpb1 promoterAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_EPHB4_Ephrin-lbd
Plasmid#109863PurposeProtein expression and purification of EPHB4_Ephrin-lbdDepositorInsertEPHB4_Ephrin-lbd (EPHB4 Human)
ExpressionBacterialAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 GABARAPL1 no-stop
Plasmid#123210PurposeGateway entry clone encoding human GABARAPL1 lacking stop codon, suitable for C-terminal taggingDepositorInsertGamma-aminobutyric acid receptor-associated protein-like 1 (GABARAPL1 Human)
UseGateway entry vector / entry cloneMutationStop codon removedAvailable SinceMay 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 GABARAPL2 no-stop
Plasmid#123211PurposeGateway entry clone encoding human GABARAPL2 lacking stop codon, suitable for C-terminal taggingDepositorInsertGamma-aminobutyric acid receptor-associated protein-like 2 (GABARAPL2 Human)
UseGateway entry vector / entry cloneMutationStop codon removedAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET-30a(+)-N-SH2+IA
Plasmid#111273Purposeexpress murine Syk (N)SH2 domain plus interdomain A (Ser 8 to His 162), with an N-terminal (His)6 tag and TEV cleavage site, in E.coli strain Rosetta 2 (DE3)DepositorInsertmurine Syk (N)SH2 domain plus interdomain A (Ser 8 to His 162), with an N-terminal (His)6 tag and TEV cleavage site (Syk Mouse)
TagsHHHHHHENLYFQGExpressionBacterialPromoterT7 promoterAvailable SinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRSM4
Plasmid#101642PurposeEncodes the fluorescent protein KCyG4219 for constitutive expression in E. coli.DepositorInsertKCyG4219
Tags6XHisExpressionBacterialMutationC-terminal residues (221-223) deletion. Ser220Val…Available SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
csd2_121-308,Y197F/pET28b(+)
Plasmid#83299Purposecsd2, construct: 121-308, pET28b(+) NC-tag, mutation: Y197FDepositorInserthp1544
TagsHis tagExpressionBacterialMutationdeleted amino acid 1-120, and changed Tyrosine 19…Available SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pScalps_puro_mIL-2Rα ST
Plasmid#59919PurposeExpresses mouse interleukin-2 receptor alpha chain mutatedDepositorInsertinterleukin 2 receptor alpha (Il2ra Mouse)
UseLentiviralMutationchanged sequence of the intracellular (C-terminal…Available SinceOct. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pM-ErbB4-delta-kinase-PY1 mutant
Plasmid#17801DepositorInsertErbB4 (ERBB4 Human)
TagsGAL4-BDExpressionMammalianMutationCarboxy-terminal fragment, amino acids 988-1292, …Available SinceMay 9, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DIO-trkB.DN-mCherry
Plasmid#121502PurposeExpresses trkB.T1 fused with mCherry in a cre dependent manner.DepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCI-Myc3-HPS4
Plasmid#133931PurposeExpresses 3xMyc-HPS4 construct in mammalian cellsDepositorInsertHPS4 (HPS4 Human)
Tags3xMyc tagExpressionMammalianMutationGlutamic acid 229 to Glycine; Valine 552 to Methi…PromoterCMV I.E.Available SinceNov. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV GFP-GABARAPL1 G116
Plasmid#123119PurposeExpresses EGFP-GABARAPL1 G116 in mammalian cells.DepositorInsertGamma-aminobutyric acid receptor-associated protein-like 1 (GABARAPL1 Human)
TagsEGFPExpressionMammalianMutationDeleted amino acid 117. Stop codon after G116PromoterCMVAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
Flag-Src Y527E
Plasmid#246428PurposeExpresses Src mutant Y527E (aka Y530E) in Mammalian cellsDepositorAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
Flag-Src Y527A
Plasmid#246429PurposeExpresses Src mutant Y527A (aka Y530A) in Mammalian cellsDepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xEcoLeuT(CUA)_AnapRS
Plasmid#140019PurposePlasmid with 4xEcoLeuT(CUA) cassette and E. coli AnapRS for amber suppression and incorporation of the fluorescent ncAA Anap; for transient or stable piggyBac-mediated integrationDepositorInsertEcoLeuRS (AnapRS)
ExpressionMammalianMutationL38F, M40G, L41P, Y499V, Y500L, Y527A, H537E, L53…PromoterEF1Available SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
8xNFAT-ZsG-muhCD4
Plasmid#162745PurposeNFAT-driven ZsGreen-1 reporter gene with mutated human CD4 geneDepositorInsert8x of NFAT binding motif follwed by ZsGreen-1 fluorescent protein gene (CD4 Human)
UseRetroviralExpressionMammalianMutationHuman CD4 gene with glutamine to tyrosine at posi…Available SinceApril 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DYRK1A-2A-mCherry
Plasmid#118272PurposeExpresses mouse DYRK1A tagged with 2A peptide at it's C-terminus and mCherry in mammalian cells.DepositorInsertdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1a (Dyrk1a Mouse)
UseAAVTags2A peptide and mCherryExpressionMammalianPromoterCMV with beta global intronAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet-v2 RsTAL At4CL
Plasmid#126524Purposeexpresses TAL (Rhodobacter sphaeroides) and 4CL (Arabidopsis thaliana paralog 1) for PYP chromophore biosynthesisDepositorInsertsTagsHisExpressionBacterialPromoterT7Available SinceJune 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only