We narrowed to 1,706 results for: nif
-
Plasmid#190388PurposePlasmids encode parts for syntetic genetic circuit construction in eudicot plants (proUBQ10::PIP2A-mCherry-NOSt_proG1090::AmtR-VP16-19St_3XAmtRO::GFPint-NLS-ADHt)DepositorInsertproUBQ10::PIP2A-mCherry-NOSt_proG1090::AmtR-VP16-19St_3XAmtRO::GFPint-NLS-ADHt
ExpressionPlantAvailable SinceApril 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
JAB2600
Plasmid#190387PurposePlasmids encode parts for syntetic genetic circuit construction in eudicot plants (proUBQ10::PIP2A-mCherry-NOSt_proG1090::AmtR-VP16-19St_2XAmtRO::GFPint-NLS-ADHt)DepositorInsertproUBQ10::PIP2A-mCherry-NOSt_proG1090::AmtR-VP16-19St_2XAmtRO::GFPint-NLS-ADHt
ExpressionPlantAvailable SinceApril 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
JAB2599
Plasmid#190386PurposePlasmids encode parts for syntetic genetic circuit construction in eudicot plants (proUBQ10::PIP2A-mCherry-NOSt_proG1090::AmtR-VP16-19St_1XAmtRO::GFPint-NLS-ADHt)DepositorInsertproUBQ10::PIP2A-mCherry-NOSt_proG1090::AmtR-VP16-19St_1XAmtRO::GFPint-NLS-ADHt
ExpressionPlantAvailable SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNL2114 pARF19 GG0-GG1
Plasmid#195909PurposeLevel 0 pARF19 promoter with GG0 and GG1 golden gate linkersDepositorInsertpARF19 (ARF19 Mustard Weed)
UseSynthetic BiologyAvailable SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
L0-I16 tUBQ1 GG5-GG6
Plasmid#195898PurposeLevel 0 tUBQ1 terminator with GG5 GG6 golden gate linkersDepositorInserttUBQ1 (UBQ1 Mustard Weed)
UseSynthetic BiologyAvailable SinceMarch 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
L0-I15 tUBQ1 GG4-GG6
Plasmid#195897PurposeLevel 0 tUBQ1 terminator with GG4 GG6 golden gate linkersDepositorInserttUBQ1 (UBQ1 Mustard Weed)
UseSynthetic BiologyAvailable SinceMarch 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJCC_103 SpCas9 T1337C
Plasmid#179525PurposeFor bacterial expression of SpCas9 T1337C (for DNA cross-linking) with an N-terminal His-MBP tagDepositorInsertSpCas9 T1337C
Tags10X His, TEV protease cleavage site, and maltose-…ExpressionBacterialMutationchanged threonine 1337 to cysteineAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR-IAA27_no stop
Plasmid#83860PurposeGateway donor vector for IAA27 with no stop codonDepositorAvailable SinceOct. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR-IAA8_no stop
Plasmid#83874PurposeGateway donor vector for IAA8 with no stop codonDepositorInsertindole-3-acetic acid inducible 8 (IAA8 Mustard Weed)
UseGateway donor vectorMutationno stop codonAvailable SinceOct. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR-IAA5_no stop
Plasmid#83868PurposeGateway donor vector for IAA5 with no stop codonDepositorAvailable SinceOct. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR-IAA3_no stop
Plasmid#83863PurposeGateway donor vector for IAA3 with no stop codonDepositorAvailable SinceOct. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR-IAA10_no stop
Plasmid#83848PurposeGateway donor vector for IAA10 with no stop codonDepositorInsertindoleacetic acid-induced protein 10 (IAA10 Mustard Weed)
UseGateway donor vectorMutationno stop codonAvailable SinceOct. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR-IAA4_no stop
Plasmid#83866PurposeGateway donor vector for IAA4 with no stop codonDepositorAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR-IAA28_no stop
Plasmid#83861PurposeGateway donor vector for IAA28 with no stop codonDepositorAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR-IAA15_no stop
Plasmid#83853PurposeGateway donor vector for IAA15 with no stop codonDepositorInsertindole-3-acetic acid inducible 15 (IAA15 Mustard Weed)
UseGateway donor vectorMutationno stop codonAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1365 LV EF1a-CD28 IRES-EGFP
Plasmid#201921Purpose2nd generation lentiviral transfer plasmid for engineering cells to express human CD28DepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1363 LV EF1a-CD19 IRES-EGFP
Plasmid#201919Purpose2nd generation lentiviral transfer plasmid for engineering cells to express human CD19DepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK172 asyn(1-122)
Plasmid#240598PurposeOverexpress truncated alpha-Synuclein proteinDepositorAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
mApple-M1 Spastin
Plasmid#134461PurposeM1 Spastin expressionDepositorInsertM1 Spastin (SPAST Human)
ExpressionMammalianMutationMet to Ala change at amino acid 87PromoterCMVAvailable SinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only