We narrowed to 15,621 results for: grna
-
Plasmid#164860PurposeConstitutive expression of single-spacer CRISPR array with spacer #3 targeting deGFP mRNA for BzCas13b in bacteria.DepositorInsertBzCas13b-gRNA-3
ExpressionBacterialPromoterJ23119Available SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLsCas13a-gRNA-3
Plasmid#164867PurposeConstitutive expression of single-spacer CRISPR array with spacer #3 targeting deGFP mRNA for LsCas13a in bacteria.DepositorInsertLsCas13a-gRNA-3
UseCRISPRExpressionBacterialPromoterJ23119Available SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLsCas13a-gRNA-2
Plasmid#164866PurposeConstitutive expression of single-spacer CRISPR array with spacer #2 targeting deGFP mRNA for LsCas13a in bacteria.DepositorInsertLsCas13a-gRNA-2
UseCRISPRExpressionBacterialPromoterJ23119Available SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
(559) pAAV EF-1a KRAB-SadCas9 U6-gRNA
Plasmid#163024PurposeExpression of CRISPRi with U6-gRNA (Bsa1 sites)DepositorInsertMammalian codon-optimized SadCas9
UseAAVTagsKRAB, SV40 polyA, and myc NLSExpressionMammalianPromoterhEF-1aAvailable SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgPBRM1-1- LentiCRISPRv2
Plasmid#107403PurposeLentiviral expression of Cas9 and gRNA targeting PBRM1DepositorInsertgRNA targeting PBRM1 (PBRM1 Human)
UseLentiviralAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSetd2#1/Cre
Plasmid#89649PurposeExpresses a Setd2-targeting gRNA and Cre-recombinaseDepositorAvailable SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 5
Plasmid#51764PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 5
UseCRISPR and LentiviralPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pADH139
Plasmid#90987PurposeNAT-marked "empty" gRNA construct for use in gRNA expression cassette stitching PCR; use with pADH110 to generate target-specific part 2 of 2 for C.mal LEUpOUT CRISPR system.DepositorInsertgRNA conserved, C, mal LEU2 2 of 2
UseCRISPRAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-L3US2-RFP-HDAC3
Plasmid#83966PurposeLentiviral CRISPR HDAC3 dual gRNA targeting vectorDepositorAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
gRNA Cloning Vector Bbs I ver. 2
Plasmid#85586PurposeAn empty sgRNA expression vector. sgRNA sequence can be cloned into its Bbs I site. Its gRNA scaffold has efficient ver. 2 structure.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceDec. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgPBRM1-2- LentiCRISPRv2
Plasmid#107404PurposeLentiviral expression of Cas9 and gRNA targeting PBRM1DepositorInsertgRNA targeting PBRM1 (PBRM1 Human)
UseLentiviralAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
ACE2 g2
Plasmid#153012PurposeA guide RNA targeting ACE2 in a lentiviral plasmid co-expressing mCherryDepositorAvailable SinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgLats1#2/Cre
Plasmid#173600PurposeExpresses a Lats1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Lats1 (Lats1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgLats1#1/Cre
Plasmid#173599PurposeExpresses a Lats1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Lats1 (Lats1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPole#2/Cre
Plasmid#173610PurposeExpresses a Pole-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Pole (Pole Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPole#1/Cre
Plasmid#173609PurposeExpresses a Pole-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Pole (Pole Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
OA-1055J
Plasmid#200251PurposepBac-U6-gRNA(Intersex)-3xp3-tdTomatoDepositorInsert2 gRNAs targeting Intersex gene
ExpressionInsectAvailable SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
AOI-WT-Cas9-sg-mouse Suz12-F2-GFP
Plasmid#91882PurposeExpresses 3xFLAG-Cas9 and a gRNA targeting mouse Suz12DepositorAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-AasgRNA3.8.3
Plasmid#121959PurposeMammalian expression, Transcription regulation, gRNA scaffoldDepositorInsertAaCas12b single chimeric gRNA, MS2 hairpin inserted
ExpressionMammalianAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only