We narrowed to 13,079 results for: BASE

#228999

For bacterial expression of anti-mouse IgG nanobody LaMIgG-12, with pelB leader for periplasmic secretion, and C-term free cysteine and C-term 6xHIS tag.

Michael Rout

Fridy et al J Biol Chem. 2024 Aug 2;300(9):107623. d

Jan. 13, 2025

Academic Institutions and Nonprofits only

#228985

For bacterial expression of anti-GST nanobody GST-3, with pelB leader for periplasmic secretion, and C-term 6xHIS tag.

Michael Rout

Fridy et al J Biol Chem. 2024 Aug 2;300(9):107623. d

Jan. 13, 2025

Academic Institutions and Nonprofits only

#112134

lenti vector encoding D10Acas9-3xflag with T2A Blastcidin resistance marker (EF1a-NLS-D10ACas9-3Xflag-T2A-Blast-WPRE)

Fei-Long Meng

Liu et al Cell Rep. 2018 Oct 23;25(4):884-892.e3.

Sept. 18, 2018

Academic Institutions and Nonprofits only

#176239

pNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux under the control of Ribi promoter

John van der Oost

Naduthodi et al ACS Synth Biol. 2021 Dec 17;10(12):3369-

Nov. 16, 2021

Academic Institutions and Nonprofits only

#211766

Multiplexed gRNA plasmid targeting six different gene promoters (PACC1-2, EPCAM-2, B2M-4, KL-3, RBM3-1, HINT1-1), with mCherry selection

Ryan Lister

Swain et al Nucleic Acids Res. 2023 Nov 24:gkad1108.

Dec. 15, 2023

Academic Institutions and Nonprofits only

#176068

EGFP fused to the C-terminus of an OB domain & a hygromycin resistance cassette

Robert Sobol

Koczor et al Cell Rep. 2021 Nov 2;37(5):109917. doi:

Jan. 25, 2022

Academic Institutions and Nonprofits only

#207767

Donor template for Puro-2A-moxGFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763

Laurence Pelletier

Philip et al EMBO J. 2024 Dec 12. doi: 10.1038/s44318

Nov. 15, 2023

Industry, Academic Institutions, and Nonprofits

#209645

To install m.G3635 mutation on mtDNA

Bin Shen

Sun et al Nat Commun. 2023 Oct 19;14(1):6625. doi:

Dec. 11, 2023

Academic Institutions and Nonprofits only

#113946

mammalian expression plasmid for c-myc-tagged human T1R2 with signal peptide of HLA class I histocompatibility antigen A-2 alpha chain

Erik Procko

Park et al J Biol Chem. 2019 Feb 5. pii: RA118.0061

Feb. 8, 2019

Academic Institutions and Nonprofits only

#87407

p425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only