We narrowed to 46,193 results for: cha
-
Plasmid#126551PurposeAAV Flex reverse plasmid with the coding sequence of eGFP fused to the N-term of the FMRFamide gated Na channelDepositorInserteGFP N-terminal fused to FMRFamide gate sodium channel
UseAAVAvailable SinceJuly 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJAK175
Plasmid#178601PurposepAP259 derived plasmid encoding a xylose inducible BitlucOptDepositorInsertBitlucopt
ExpressionBacterialPromoterPxylAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO mTRPM7
Plasmid#45482DepositorInsertTRPM7 (Trpm7 Mouse)
UseTetracycline inducibleTagsFlagExpressionMammalianPromoterTetracycline-controlled CMVAvailable SinceMay 21, 2013AvailabilityAcademic Institutions and Nonprofits only -
pWP001
Plasmid#178596PurposepAF256 derived plasmid encoding a xylose inducible CD16/50L CBD-SmBiT and LgBiTDepositorInsertCBD-SmBiT/LgBiT
ExpressionBacterialPromoterPxylAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7m-psMEK2
Plasmid#89363PurposeA lenti-viral vector expressing photoswitchable MEK2 in mammalian cellsDepositorInsertpsMEK2 (MAP2K2 Human, Synthetic)
UseLentiviralTagsHuman influenza hemagglutinin (HA) tag and pdDron…ExpressionMammalianPromoterCMVAvailable SinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-AntiHer2-LC122-TAG
Plasmid#226839PurposeContains trastuzumab with a TAG codon at position 122 of the light chain for ncAA incorporationDepositorInsertsanti-HER2 light chain
anti-HER2 heavy chain
UseAffinity Reagent/ AntibodyExpressionMammalianMutationamino acid 122 of light chain mutated to TAGAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-AntiHer2-HC197-TAG
Plasmid#226838PurposeContains trastuzumab with a TAG codon at position 197 of the heavy chain for ncAA incorporationDepositorInsertsanti-HER2 light chain
anti-HER2 heavy chain
UseAffinity Reagent/ AntibodyExpressionMammalianMutationamino acid 197 of heavy chain mutated to TAGAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7m-psMEK1tight
Plasmid#89362PurposeA lenti-viral vector expressing photoswitchable MEK1 with minimum basal activity in mammalian cellsDepositorInsertpsMEK1tight (MAP2K1 Human, Synthetic)
UseLentiviralTagsHuman influenza hemagglutinin (HA) tag and pdDron…ExpressionMammalianPromoterCMVAvailable SinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7m-psMEK1
Plasmid#89361PurposeA lenti-viral vector expressing photoswitchable MEK1 in mammalian cellsDepositorInsertpsMEK1 (MAP2K1 Human, Synthetic)
UseLentiviralTagsHuman influenza hemagglutinin (HA) tag and pdDron…ExpressionMammalianPromoterCMVAvailable SinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only