We narrowed to 16,319 results for: grna
-
Plasmid#134633Purposecontains sgRNA targeting human UFM1 for gene knockoutDepositorInsertUFM1 sgRNA1 (UFM1 Human)
ExpressionMammalianAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
ALDH18A1 gRNA (BRDN0001149056)
Plasmid#77994Purpose3rd generation lentiviral gRNA plasmid targeting human ALDH18A1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PDGFRA gRNA (BRDN0001148373)
Plasmid#75493Purpose3rd generation lentiviral gRNA plasmid targeting human PDGFRADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE1-gRNA#1
Plasmid#107726PurposeKnock out of EB1 in human cells by CRISPR/Cas9DepositorAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
PIK3C2B gRNA (BRDN0001145952)
Plasmid#76714Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3C2BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pShoCAST-sgRNA_entry (BO1)
Plasmid#181786PurposeExpresses ShoCAST. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertShoTnsB, ShoTnsC, ShoTniQ, ShoCas12k
ExpressionBacterialPromoterLac and J23119Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pShoHELIX-sgRNA_entry (BO3)
Plasmid#181784PurposeExpresses ShoHELIX containing a nicking I-AniI fusion to ShoTnsB. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertnAniI-ShoTnsB, ShoTnsC, ShoTniQ, ShoCas12k
ExpressionBacterialMutationnAniI = K227M, F80K, L232KPromoterLac and J23119Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
MAPK14 gRNA (BRDN0001145809)
Plasmid#77923Purpose3rd generation lentiviral gRNA plasmid targeting human MAPK14DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ERN1 gRNA (BRDN0001146341)
Plasmid#76408Purpose3rd generation lentiviral gRNA plasmid targeting human ERN1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTK73.ChrII_ttTi5605.sgRNA
Plasmid#194058PurposesgRNA targeting ChrII_ttTi5605 locus of the C. elegans genomeDepositorInsertChrII_ttTi5605 sgRNA
ExpressionWormPromoterU6Available SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTK73.ChrV_oxTi365.gRNA
Plasmid#194052PurposesgRNA targeting ChrV_oxTi365 locus of the C. elegans genomeDepositorInsertChrV_oxTi365 sgRNA
ExpressionWormPromoterU6Available SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX335A_hCas9(D10A)_IRF8gRNA1
Plasmid#89719PurposeKnockout IRF8 in human cellsDepositorAvailable SinceSept. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
JAK1 gRNA (BRDN0001144778)
Plasmid#76393Purpose3rd generation lentiviral gRNA plasmid targeting human JAK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CHEK2 C3.2 gRNA
Plasmid#90628Purpose3rd generation lentiviral gRNA plasmid targeting human CHEK2DepositorInsertCHEK2 (Guide Designation C3.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA2 gRNA (BRDN0001148851)
Plasmid#75734Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
BRD4 gRNA (BRDN0001147232)
Plasmid#77345Purpose3rd generation lentiviral gRNA plasmid targeting human BRD4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SMC6 G4.4 gRNA
Plasmid#90899Purpose3rd generation lentiviral gRNA plasmid targeting human SMC6DepositorInsertSMC6 (Guide Designation G4.4)
UseCRISPR and LentiviralPromoterU6Available SinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
SMC6 G3.4 gRNA
Plasmid#90898Purpose3rd generation lentiviral gRNA plasmid targeting human SMC6DepositorInsertSMC6 (Guide Designation G3.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
TK1 gRNA (BRDN0001145069)
Plasmid#76424Purpose3rd generation lentiviral gRNA plasmid targeting human TK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only