We narrowed to 14,240 results for: Cas9
-
Plasmid#199342Purposeencodes sgRNA for human PLD3 KO, (target Exon 7) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-RFPExpressionMammalianPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
hPLD4-sgRNA-Cas9_mcherry
Plasmid#199343Purposeencodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-mCherryExpressionMammalianMutationsgRNA: accagtagtatgaagccacgPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX458-3xHA-dFnCas9
Plasmid#201954PurposeMammalian expression plasmid of dead FnCas9 with T2A-EGFP and cloning backbone for sgRNADepositorInsert3xHA-NLS-dFnCas9-T2A-EGFP
UseCRISPRTags3xHA, NLS, and T2A-EGFPExpressionMammalianMutationD11A and H969A on FnCas9PromoterCbhAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX458-3xHA-FnCas9ABEmax8.17d
Plasmid#201955PurposeMammalian expression plasmid of FnCas9ABEmax8.17d base editor with T2A-EGFP and cloning backbone for sgRNADepositorInsertbpNLS-FnCas9ABEmax8.17d-bpNLS-3xHA-T2A-EGFP
UseCRISPRTags3xHA, NLS, and T2A-EGFPExpressionMammalianMutationD11A on FnCas9, V82S, V106W, Q154R on mutant TadAPromoterCbhAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-His6-en1dFnCas9GFP
Plasmid#201950PurposeExpression of en1dFnCas9-GFP in bacterial cellsDepositorInsertExpression of en1dFnCas9-GFP in bacterial cells
UseCRISPRTags6x His, HA, NLS, and mEGFPExpressionBacterialMutationE1369R on FnCas9PromoterT7Available SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-His6-en15dFnCas9GFP
Plasmid#201951PurposeExpression of en15dFnCas9-GFP in bacterial cellsDepositorInsertExpression of en15dFnCas9-GFP in bacterial cells
UseCRISPRTags6x His, HA, NLS, and mEGFPExpressionBacterialMutationE1603H on FnCas9PromoterT7Available SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX458-3xHA-dSpCas9
Plasmid#201953PurposeMammalian expression plasmid of dead SpCas9 with T2A-EGFP and cloning backbone for sgRNADepositorInsert3xHA-NLS-dSpCas9-T2A-EGFP
UseCRISPRTags3xHA, NLS, and T2A-EGFPExpressionMammalianMutationD10A and H840A on SpCas9PromoterCbhAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Hyg-nCas9n
Plasmid#217487PurposeExpression of nuclear nCas9nDepositorInsertCas9
UseCRISPRTagsSV40 NLSExpressionMammalianPromoterCMVAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-spCas9-pZeo
Plasmid#214121PurposeGene expression by Piggybac transposase in mammalian cellsDepositorInsertspCas9
UseCRISPRExpressionMammalianMutationCodon-optimized for mammalian cellsAvailable SinceFeb. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX458-tRNA-SpCas9
Plasmid#195183PurposeVector for transient Cas9 and EGFP expression. Small tRNA promoter for sgRNA cloning by GoldenGate.DepositorInsertCas9
UseCRISPRPromotertRNA-GlnAvailable SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_NoFlag_ATP1A1_G3_SLBP_G1_Dual_sgRNA
Plasmid#191528PurposeVector for tandem expression of SLBP 3'UTR G1 sgRNA in combination with ATP1A1 G3 sgRNA from two independent U6 promoters to facilitate SLBP endogenous tagging by marker free coselection using ouabainDepositorInsertSLBP 3'UTR G1 sgRNA + ATP1A1 G3 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via hdr using ouabainExpressionMammalianAvailable SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR/eCas9-GPIDAF
Plasmid#213710PurposeTo express a single-guide RNA under a U6 promoter, accompanied by the expression of eCas9 and the affinity sorting tag TST-EGFP-GPIDAF under separate promoters.DepositorInsertEGFP
UseCRISPRTags3XFLAG and Twin-strep-tagPromoterCMVAvailable SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR/eCas9-GPIBY55
Plasmid#213709PurposeTo express a single-guide RNA under a U6 promoter, accompanied by the expression of eCas9 and the affinity sorting tag TST-EGFP-GPIBY55 under separate promoters.DepositorInsertEGFP
UseCRISPRTags3XFLAG and Twin-strep-tagExpressionMammalianPromoterCMVAvailable SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Cas9-ZNF746
Plasmid#207822PurposeDual expression of Cas9 and sgRNA targeting ZNF746DepositorAvailable SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
dCas9-RPT6-FLAG
Plasmid#205416PurposeExpresses dCas9-RPT6 with FLAG labelDepositorAvailable SinceDec. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV_dCas9-KRAB_sgSTK4i_#1 (PuroR)
Plasmid#209773PurposeCRISPRi for STK4DepositorAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV_dCas9-KRAB_sgSTK3i_#2 (PuroR)
Plasmid#209772PurposeCRISPRi for STK3DepositorAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV_dCas9-KRAB_sgSTK4i_#2 (PuroR)
Plasmid#209774PurposeCRISPRi for STK4DepositorAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV_dCas9-KRAB_sgSTK3i_#1 (PuroR)
Plasmid#209771PurposeCRISPRi for STK3DepositorAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV_dCas9-ZIM3-KRAB_sgTAOK2i_#1
Plasmid#172983PurposeCRISPRi for TAOK2DepositorAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only