We narrowed to 2,405 results for: dcas9
-
Plasmid#187950PurposeecDHFR degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertecDHFR-SpdCas9-tagRFPt-P2A-tagBFP
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorPublicationInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available sinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Hyg-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196082Purpose(Empty Backbone) Inducible CRISPRi vector conferring hygromycin B resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
Aminoglycoside phosphotransferase
UseCRISPRExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
GCN5 FL-dCas9-p300 core
Plasmid#179554Purposeencodes S. pyogenes dCas9 with n-terminal fusion of full length human GCN5 and c-terminal fusion of human p300 core (aa 1048-1664) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJT340 Lenti pEF-dCas9-3XFLAG-KRAB[WSR7EEE] + MGA1+2 + RYBP-T2A-tagBFP-P2A-Blast
Plasmid#187344PurposedCas9 effector fusion for manipulating transcriptionDepositorInsertdCas9-3XFLAG-KRAB[WSR7EEE] + MGA1+2 + RYBP-T2A-tagBFP-P2A-Blast
UseCRISPR and LentiviralTags3XFLAGExpressionMammalianMutationKRAB WSR7EEEPromoterpEF1aAvailable sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP RING-PHD-HAT
Plasmid#179549Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human CBP RING-PHD-HAT domain (aa 1191-1701) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human CBP RING-PHD-HAT domain (aa 1191-1701) (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-p300 RING-PHD-HAT
Plasmid#179546Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 RING-PHD-HAT domain (aa 1155-1664) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human p300 RING-PHD-HAT domain (aa 1155-1664) (EP300 Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-BD10-SAS620-3’dCas9-VPR-synpA
Plasmid#216323PurposeTransactivation of murine Myo7b gene via split dCas9-VPR (REVeRT system).DepositorInsertSplit Cas9-VPR + splice acceptor site
UseAAVPromoterCMVAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-3xsgMyo7b-CMV-5’dCas9-SDS-BD10-SV40pA
Plasmid#216322PurposeTransactivation of murine Myo7b gene via split dCas9-VPR (REVeRT system).DepositorInsertSplit Cas9-VPR + splice donor site + gRNAs targeting the murine Myo7b locus for transactivation
UseAAVPromoterCMVAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSLPB2B-SMASh-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
Plasmid#187949PurposeSMASh degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertSMASh-SpdCas9-tagRFPt-P2A-tagBFP
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJT259 Lenti pEF-dCas9-3XFLAG-VP64-T2A-tagBFP-P2A-Blast
Plasmid#187335PurposedCas9 effector fusion for manipulating transcriptionDepositorInsertCas9-3XFLAG-VP64-T2A-tagBFP-P2A-Blast
UseCRISPR and LentiviralTags3XFLAGExpressionMammalianPromoterpEF1aAvailable sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-p300 Core (H1415A/E1423A/Y1424A/L1428S/Y1430A/H1434A)
Plasmid#61364Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; inactivating mutations H1415A/E1423A/Y1424A/L1428S/Y1430A/H1434A) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 Human, S. pyogenes, Synthetic)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9; H1415A/E1423A/Y14…PromoterCMVAvailable sinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
TetO-FUW-VdC9BV
Plasmid#62195PurposeExpresses RNA-Guided, Nuclease-Inactive VP64:dCas9-BFP:VP64—VdC9BV—Fusion Protein to Enable Transactivation of Endogenous GenesDepositorInsertVP64dCas9BFPVP64
UseLentiviralTagsTwo VP64s tagged to dCas9 fused to BFPExpressionMammalianMutationD10A H840A (catalytically inactive) Cas9 (dCas9)Available sinceJune 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-p300 Core (C1204R)
Plasmid#61361Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; mutation C1204R) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 Human, S. pyogenes, Synthetic)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9; C1204R mutation i…PromoterCMVAvailable sinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMSP3545-dCas9Str
Plasmid#153516PurposeExpresses dCas9str under nisin-inducible nisA promoter in pMSP3545 backboneDepositorInsertdCas9Str
ExpressionBacterialPromoternisAAvailable sinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLPB3B-AID-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin-T2A-osTIR1
Plasmid#187960PurposeAID degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance, T2A site and osTIR1 under PGK promoter.DepositorInsertAID-SpdCas9-tagRFPt-P2A-tagBFP; Blasticidin-T2A-osTIR1
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLPB3B-mAID-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin-T2A-osTIR1
Plasmid#187963PurposemAID degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance, T2A site and osTIR1 under PGK promoter.DepositorInsertsAID-SpdCas9-tagRFPt-P2A-tagBFP; Blasticidin-T2A-osTIR1
osTIR1
UseCRISPR and Synthetic BiologyTagsGGS linker and T2AExpressionMammalianAvailable sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-)-HF2-BE2
Plasmid#120396PurposeExpresses HF2-BE2 in mammalian cellsDepositorInsertHF2-BE2
ExpressionMammalianMutationMammalian codon-optimized Cas9-HFPromoterCMVAvailable sinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
PB-SAM-Dest
Plasmid#102563PurposePiggybac transposon DEST vector encoding dCAS9-VP64 and MS2-P65-HSF1 activator helper complex. It is used for insertion of multiple U6-sgRNA expression cassettes.DepositorTypeEmpty backboneUseCRISPR; Piggybac transposonExpressionMammalianPromoterN/AAvailable sinceJan. 5, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA-dCas9-p300 Core (1396/1397 SY/WW)
Plasmid#61363Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; inactivating mutation 1396/1397 SY/WW) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 Human, S. pyogenes, Synthetic)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9; 1396/1397 SY/WW m…PromoterCMVAvailable sinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only