-
Plasmid#214689PurposeLentiviral expression vector for an inducible Cas9-P2A-Puromycin resistance casette with two sgRNA sequences against human TP73DepositorInsertdgRNA_TP73 (TP73 Human)
UseCRISPR and LentiviralTagsExpressionMutationPuromycin resistance cassette has silent mutation…PromoterAvailable sinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET22b-Empty-cleavableELP
Plasmid#219401PurposeInsert protease recognition site with BsaI to make custom protease-responsive elastin-like polypeptide (ELP)DepositorInsertEmpty-cleavableELP
UseTags6xHisExpressionBacterialMutationPromoterAvailable sinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGAT
Plasmid#112587PurposeUsed for expression of protein in E. coli as Thrombin cleavable 6His-tag-GST fusions with a blunt end restriction site immediately after thrombin recognition sequenceDepositorTypeEmpty backboneUseTags6His-GSTExpressionBacterialMutationPromoterAvailable sinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
p201N 1510a.2
Plasmid#55770PurposeContains soybean miRNA miR1510a.2 recognition sequence (ATGGGTGGAATAGGGAAAACAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiTagsExpressionMutationPromoterGmUbiAvailable sinceOct. 23, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
p201N 5770
Plasmid#55772PurposeContains soybean miRNA miR5770 recognition sequence (TCTTGTCCAAACCATAGTCCAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiTagsExpressionMutationPromoterGmUbiAvailable sinceSept. 26, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
p201N 1510
Plasmid#55771PurposeContains soybean miRNA miR1510 recognition sequence (AGGTGGAATAGGAAAAACAACT) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiTagsExpressionMutationPromoterGmUbiAvailable sinceSept. 26, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
p201N 3514
Plasmid#55769PurposeContains soybean miRNA miR3514 recognition sequence (AAGGTCTCTGTCTTAATGGTGA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiTagsExpressionMutationPromoterGmUbiAvailable sinceAug. 21, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEXP5-NT-AlleyCat
Plasmid#41715DepositorInsertmutated C-terminal portion of calmodulin gene (M76-K148)
UseTagsPolyhistidine (6×His) region, TEV recognition sit…ExpressionBacterialMutationF92EPromoterT7Available sinceMay 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pINTO_7/8
Plasmid#206431PurposeA vector backbone (pCC1BAC-based) containing a single SapI recognition site. When digested, it exposes overhangs that allow integration of the vector into the P. tricornutum chloroplast genome.DepositorTypeEmpty backboneUseTagsExpressionBacterial and YeastMutationPromoterAvailable sinceJan. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCHAP2
Plasmid#206847PurposeA plasmid containing a 15,249 bp fragment of the P. tricornutum chloroplast genome. The fragment is flanked by SapI recognition sites, allowing it to be released from the cloning vector pSAP1.DepositorTypeEmpty backboneUseTagsExpressionBacterial and YeastMutationPromoterAvailable sinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCHAP1
Plasmid#206846PurposeA plasmid containing a 14,519 bp fragment of the P. tricornutum chloroplast genome. The fragment is flanked by SapI recognition sites, allowing it to be released from the cloning vector pSAP1.DepositorTypeEmpty backboneUseTagsExpressionBacterial and YeastMutationPromoterAvailable sinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pZE-PpadC-yveF-yveG-egfp
Plasmid#201791Purposethe promoter can be recognized by PadRDepositorInsertPpadC-yveF-yveG
UseTagsExpressionBacterialMutationWTPromoterAvailable sinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGGA004
Plasmid#48815PurposeProvides the 35S promoter as GreenGate module.DepositorInsert35S promoter
UseGolden gate compatible cloning vectorTagsExpressionMutationinternal BsaI recognition site removed by substit…PromoterAvailable sinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pILxR5
Plasmid#149497PurposeBroad-Host range expression vector, pUC origin, Tn7 recognition sites, LuxR activator, PLuxB promoter, mRFP, Gentamicin Resistance Marker.DepositorInsertLuxR-mRFP
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPLuxBAvailable sinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pIVR5
Plasmid#167510PurposeBroad-Host range expression vector, pUC origin, Tn7 recognition sites, VanRAM repressor, PVanCC promoter, mRFP, Gentamicin Resistance Marker.DepositorInsertVanRAM-mRFP
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPVanCCAvailable sinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-PUb-SSA
Plasmid#52910PurposeAe aegypti PUb promoter Single Stranded Annealing reporterDepositorInsertLuciferase duplication-TALEN recognition sites
UseLuciferaseTagsExpressionMutationPromoterAe aegypti polyubiquitinAvailable sinceMay 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCHAP8
Plasmid#206857PurposeA plasmid containing a 11,944 bp fragment of the P. tricornutum chloroplast genome. The fragment is flanked by SapI recognition sites, allowing it to be released from the cloning vector pSAP1.DepositorTypeEmpty backboneUseTagsExpressionBacterial and YeastMutationPromoterAvailable sinceFeb. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCHAP7
Plasmid#206853PurposeA plasmid containing a 13,748 bp fragment of the P. tricornutum chloroplast genome. The fragment is flanked by SapI recognition sites, allowing it to be released from the cloning vector pSAP1.DepositorTypeEmpty backboneUseTagsExpressionBacterial and YeastMutationPromoterAvailable sinceFeb. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCHAP6
Plasmid#206852PurposeA plasmid containing a 15,671 bp fragment of the P. tricornutum chloroplast genome. The fragment is flanked by SapI recognition sites, allowing it to be released from the cloning vector pSAP1.DepositorTypeEmpty backboneUseTagsExpressionBacterial and YeastMutationPromoterAvailable sinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCHAP5
Plasmid#206851PurposeA plasmid containing a 17,639 bp fragment of the P. tricornutum chloroplast genome. The fragment is flanked by SapI recognition sites, allowing it to be released from the cloning vector pSAP1.DepositorTypeEmpty backboneUseTagsExpressionBacterial and YeastMutationPromoterAvailable sinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only