We narrowed to 7,309 results for: aav
-
Plasmid#178727PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of GCaMP6f in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertGCaMP6f
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD6-GCaMP6f
Plasmid#178729PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of GCaMP6f in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertGCaMP6f
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS5-GCaMP6f
Plasmid#178731PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of GCaMP6f in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertGCaMP6f
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS6-GCaMP6f
Plasmid#178732PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of GCaMP6f in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertGCaMP6f
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD5-dTom
Plasmid#178716PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of dTom in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertdTom
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD4-GFP
Plasmid#178709PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of GFP in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertGFP
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD5-GFP
Plasmid#178710PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of GFP in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertGFP
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD6-GFP
Plasmid#178711PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of GFP in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertGFP
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-G-Cdc42
Plasmid#180582PurposeddGFP sensor of Cdc42DepositorInsertddGFP sensor of Cdc42
UseAAVAvailable SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EGFP.T2A.NCLX.3'UTR
Plasmid#181872PurposeExpresses EGFP and murine NCLX (separated by a T2A cleavage site) under control of the synthetic CAG promoter (includes a large portion of the Slc8b1 3'UTR)DepositorInsertsUseAAV and AdenoviralTagsHA, T2A, and mycExpressionMammalianMutationincludes a large portion of the Slc8b1 3'UTR…Promotersynthetic hybrid CAG promoterAvailable SinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iDianiSnFR_PM
Plasmid#177759PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertpAAV9-hSyn-iDianiSnFR_PM
UseAAVPromoterhSynAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iDianiSnFR_ER
Plasmid#177758PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertpAAV9-hSyn-iDianiSnFR_ER
UseAAVPromoterhSynAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iCyt_F_SnFR_PM
Plasmid#177755PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertpAAV9-hSyn-iCyt_F_SnFR_PM
UseAAVPromoterhSynAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iCytSnFR_PM
Plasmid#177753PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertpAAV9-hSyn-iCytSnFR_PM
UseAAVPromoterhSynAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iCytSnFR_ER
Plasmid#177752PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertpAAV9-hSyn-iCytSnFR_ER
UseAAVPromoterhSynAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn iCyt_BrEt_SnFR_ER
Plasmid#177756PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertpAAV9-hSyn iCyt_BrEt_SnFR_ER
UseAAVPromoterhSynAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iCyt_F_SnFR_ER
Plasmid#177754PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertpAAV9-hSyn-iCyt_F_SnFR_ER
UseAAVPromoterhSynAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV_Donor/Reporter-COL4A3
Plasmid#130279PurposeCOL4A3 mutation-specific sgRNA under the control of U6 promoter; mCherry-sgRNA target-(out of frame)EGFP expression cassette; COL4A3 donor templateDepositorInsertmCherry-eGFP
UseAAVPromoterCMVAvailable SinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-LAP1-mCherry
Plasmid#159525PurposeExpresses mCherry from LAP1 promoterDepositorInsertmCherry
UseAAVExpressionMammalianPromoterLAP1Available SinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA s3
Plasmid#132395PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only