We narrowed to 3,415 results for: guide rna expression plasmid
-
Plasmid#215866PurposeThis plasmid encodes sgRNA that target Renilla luciferase with stretch sequenceDepositorInsertsgRNA-RL714 with TTTT stretch
UseRetroviralExpressionMammalianAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-RL69-CTTT
Plasmid#215852PurposeThis plasmid encodes sgRNA that target Renilla luciferase with stretch sequenceDepositorInsertsgRNA-RL69 with CTTT stretch
UseRetroviralExpressionMammalianAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-RL69-TTTA
Plasmid#215851PurposeThis plasmid encodes sgRNA that target Renilla luciferase with stretch sequenceDepositorInsertsgRNA-RL69 with TTTA stretch
UseRetroviralExpressionMammalianAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-RL864-WT(TTTT)
Plasmid#215858PurposeThis plasmid encodes sgRNA that target Renilla luciferase with stretch sequenceDepositorInsertsgRNA-RL864 with TTTT stretch
UseRetroviralExpressionMammalianAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-RL554-WT(TTTT)
Plasmid#215862PurposeThis plasmid encodes sgRNA that target Renilla luciferase with stretch sequenceDepositorInsertsgRNA-RL554 with TTTT stretch
UseRetroviralExpressionMammalianAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-RL69-TTAT
Plasmid#215850PurposeThis plasmid encodes sgRNA that target Renilla luciferase with stretch sequenceDepositorInsertsgRNA-RL69 with TTAT stretch
UseRetroviralExpressionMammalianAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-RL69-TATT
Plasmid#215849PurposeThis plasmid encodes sgRNA that target Renilla luciferase with stretch sequenceDepositorInsertsgRNA-RL69 with TATT stretch
UseRetroviralExpressionMammalianAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-EGFP12-WT(TTTT)
Plasmid#215856PurposeThis plasmid encodes sgRNA that target EGFP with stretch sequenceDepositorInsertsgRNA-EGFP12 with TTTT stretch
UseRetroviralExpressionMammalianAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-RL69-TTTC
Plasmid#215855PurposeThis plasmid encodes sgRNA that target Renilla luciferase with stretch sequenceDepositorInsertsgRNA-RL69 with TTTC stretch
UseRetroviralExpressionMammalianAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-RL69-TCTT
Plasmid#215853PurposeThis plasmid encodes sgRNA that target Renilla luciferase with stretch sequenceDepositorInsertsgRNA-RL69 with TCTT stretch
UseRetroviralExpressionMammalianAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-RL69-TTCT
Plasmid#215854PurposeThis plasmid encodes sgRNA that target Renilla luciferase with stretch sequenceDepositorInsertsgRNA-RL69 with TTCT stretch
UseRetroviralExpressionMammalianAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
1046E=dgRNAs[traB,bTub]
Plasmid#149425PurposeThe attB plasmid with the mini-white harboring two U6.3-gRNAs targeting Dmel tra and bTub genes.DepositorInsertU6.3-gRNAs[TraB, bTub]
UseCRISPRExpressionInsectPromoterU6.3Available SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRNA-lib 2.0
Plasmid#89638PurposesgRNA expression in mammalian cells after Gateway cloningDepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterhU6Available SinceFeb. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKLV-U6gRNA(BbsI)-PGKpuro2ABFP
Plasmid#50946PurposeAn empty gRNA expression vectorDepositorInsertNone
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pXR003: CasRx gRNA cloning backbone
Plasmid#109053PurposehU6-driven expression of guide RNAs compatible with CasRx. 5' processed DR followed by BbsI sites for guide cloning.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPRExpressionMammalianPromoterhU6Available SinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
MS2_adRNA-MCP_ADAR2 DD (E488Q)_NES
Plasmid#124707PurposeExpresses MS2_adRNA targeting the RAB7A transcript along with the MCP_ADAR2 DD(E488Q)_NESDepositorInsertMCP_ADAR2 DD (E488Q)_NES
UseAAVTagsNESExpressionMammalianMutationE488Q hyperactive mutantPromoterCMVAvailable SinceSept. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
MS2_adRNA-MCP_ADAR1 DD (E1008Q)_NES
Plasmid#124703PurposeExpresses MS2_adRNA targeting the RAB7A locus along with MCP_ADAR1 DD (E1008Q)_NESDepositorInsertMCP_ADAR2 DD (E1008Q)_NES
UseAAVTagsNESExpressionMammalianMutationE1008Q hyperactive mutantPromoterCMVAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only