We narrowed to 10,184 results for: tre promoter
-
Plasmid#122018PurposeExpresses IUP pathway genes (ChK, IPK, idi) under constitutive promoter. Kan. resist.DepositorInsertsExpressionBacterialMutationCodon optimized for E. coliPromoterpro4Available SinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only
-
SECURE miniABEmax-V82G (pJUL1828)
Plasmid#131313PurposeCMV promoter expression plasmid for bpNLS-TadA7.10(V82G)-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS (miniABEmax with V82G mutation).DepositorInsertbpNLS-TadA7.10(V82G)-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS
ExpressionMammalianPromoterCMVAvailable SinceSept. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a-Nlux
Plasmid#176239PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux under the control of Ribi promoterDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferasePromoterRibosomal subunitAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pICSL11060
Plasmid#68264PurposeLevel 1 Golden Gate Cassette: Cas9 expression cassette for plants (exemplified in Brassica oleracea)DepositorInsertPromoter/5UTR: CsVMV+ CDS:SpCas9 + 3UTR/terminator:35s
UseSynthetic BiologyExpressionPlantAvailable SinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pC-BAR-YR
Plasmid#61766PurposeYeast recombinational cloning compatible Agrobacterium tumefaciens ternary vector containing bar gene (for resistance against glufosinate ammonium) on transfer DNA (TDNA).DepositorInsertsBar gene
2 micron origin or replication and URA3 gene for S. cerevisiae
UseTernary vector for agrobacterium mediated transfo…PromotertrpC promoterAvailable SinceMay 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hlbCas12a-Nlux
Plasmid#176240PurposepNOC episomal plasmid harboring the humanized lbCas12a gene sequence tagged with Nlux under the control of Ribi promoterDepositorInserthumanized lbCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferasePromoterRibosomal subunitAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
LITE2.0_pAAV_hSyn_TALE(Grm2)-GS-CIB1(NLS*,∆318-334)_WPRE_bGHpA
Plasmid#47456PurposeLITE2.0 TALE-CIB1. Changes from LITE1.0: glycine-serine linker, mutated endogenous NLS, aa318-334 deletion. This particular TALE targeted to Grm2. Synapsin promoter for neuronal expression.DepositorInsertTALE(Grm2)-GS-CIB1(NLS*,∆318-334)
UseAAV; TaleTagsHAExpressionMammalianPromoterhSyn human synapsin (mammalian neuronal expressio…Available SinceNov. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTET-IUPi
Plasmid#122019PurposeExpresses IUP pathway genes (ChK, IPK, idi) under inducible promoter. aTC inducible. Kan. resist.DepositorInsertsExpressionBacterialMutationCodon optimized for E. coliPromoterpTETAvailable SinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAc5-STABLE2-neo-RvCAHS3
Plasmid#192472PurposeStable expression of RvCAHS3 (fly codon optimized) in Drosophila cellsDepositorInsertCAHS3
TagsT2A-EGFP-T2A-neoRExpressionInsectPromoterAc5 promoterAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only