We narrowed to 27,152 results for: Cat
-
Plasmid#135464PurposeBacterial expression of uTEV3 (full-length) proteaseDepositorInsertHis6-MBP-uTEV3
TagsMBP, His6ExpressionBacterialMutationS219V mutation (improves stability) , I138T/S153N…PromoterT5Available SinceJan. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHRdSV40-scFv-GCN4-sfGFP-VP64-GB1-NLS
Plasmid#60904PurposeThe plasmid encodes a antibody that binds to the GCN4 peptide from the SunTag system, and is fused to a transcriptional activation domain VP64DepositorInsertscFv-GCN4
UseLentiviralExpressionMammalianAvailable SinceNov. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
SGTA-EGFP
Plasmid#210373PurposeExpresses SGTA fused with EGFP in mammalian cellsDepositorAvailable SinceDec. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-U-TVA950
Plasmid#115236PurposeLentiviral transfer plasmid for expression of TVA950DepositorInsertTVA950
ExpressionMammalianAvailable SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
p5E-EF1a/b-actin
Plasmid#82583Purpose5' entry vector containing the EF1a/B-globin fused to zebrafish b-actin 2 enhancer/promoter for strong semi-ubiquitous expressionDepositorInsertEF1a/b-globin fused to zebrafish b-actin 2 enhancer/promoter
PromoterNoneAvailable SinceDec. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMU-PERr
Plasmid#61202PurposeFluorescent reporter for peroxisomes mCherry-SKL expressed under AtUBQ10 promoterDepositorInsertmCherry-SKL
TagsmCherryExpressionPlantPromoterAtUBQ10Available SinceApril 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
His6_MBP_FMRP_P451S
Plasmid#198693PurposeExpression of human FMRP protein in E. coliDepositorInsertFMR1 (FMR1 Human)
TagsMBPExpressionBacterialMutationchanged proline 451 to serinePromoterT7Available SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLX-EF1a_NKX2-1_CdTag-HA
Plasmid#221493PurposeNKX2-1 short isoform lentiviral overexpression of C-terminal dTag fusionDepositorAvailable SinceJuly 2, 2024AvailabilityAcademic Institutions and Nonprofits only -