-
Plasmid#1810DepositorInsertNeo/BB2
UseTagsBB2ExpressionBacterialMutationPromoterAvailable sinceMay 19, 2005AvailabilityAcademic Institutions and Nonprofits only -
BB2/neo
Plasmid#1811DepositorInsertBB2/neo
UseTagsBB2ExpressionBacterialMutationPromoterAvailable sinceMay 19, 2005AvailabilityAcademic Institutions and Nonprofits only -
-
pIM23
Plasmid#132586PurposepZA4-oxySp-mCherry-TEVrs-LAADepositorInsertsoxySp-mCherry-TEVrs-LAA-TermT1
None
UseTagsExpressionBacterialMutationPromoternone and oxySpAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
puC19 preACT1(del6) A259C
Plasmid#111329PurposeT7 transcriptionDepositorInsertACT1
UseTagsExpressionBacterialMutationbranch site A259CPromoterAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
puC19 preACT1(del6) C256A
Plasmid#111331PurposeT7 transcriptionDepositorInsertACT1
UseTagsExpressionBacterialMutationbranch site C256APromoterAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
AAV8R-12 Capsid
Plasmid#213968PurposeAAV packaging vector carrying AAV2 rep gene and Cap8R modified AAV8 capsid coding sequenceDepositorTypeEmpty backboneUseAAVTagsExpressionMutationPromoterAvailable sinceMarch 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR-v2-HygR-EGFP
Plasmid#167188PurposeLentiviral expression of sgRNA with hygromycin resistance gene and EGFPDepositorInsertHygromycin B phosphotransferase and EGFP
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR-v2-HygR-mCherry
Plasmid#167189PurposeLentiviral expression of sgRNA with hygromycin resistance gene and mCherryDepositorInsertHygromycin B phosphotransferase and mCherry
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-TetO-hNGN2-Neo
Plasmid#99378PurposeExpresses human NEUROGENIN2 (hNGN2) and neomycin resistance gene under control of TetON promoter. 3rd generation lentiviral backbone.DepositorInserthNGN2-P2A-Neo (NEUROG2 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterTetOAvailable sinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
8xNFAT-ZsG-hCD8
Plasmid#153417PurposeNFAT-driven ZsGreen-1 reporter gene with human CD8ab geneDepositorInsert8x of NFAT binding motif follwed by ZsGreen-1 fluorescent protein gene (Cd8a )
UseRetroviralTagsExpressionMammalianMutationPromoterAvailable sinceJuly 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-BI-hTFR1
Plasmid#218796PurposeRepCap for AAV productionDepositorInsertAAV Rep-Cap BI-hTFR1
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHEE401E
Plasmid#71287PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter), Hyg resistanceDepositorInsertsgRNA scaffold
zCas9
UseCRISPR; Plant binary vectorTags3x FLAG and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterEC1.2 enhancer fused to EC1.1 promoter and U6-26p…Available sinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
TriEx-4 DHX36
Plasmid#68368PurposeExpresses the N-terminal histidine-tagged DXH36 gene product upon transfection into Rosetta 2 E. coli and induction with IPTG.DepositorInsertDHX36 (DHX36 Human)
UseTagsHistidineExpressionBacterial, Insect, and Mamm…MutationPromoterCMV ie enhancer/promoterAvailable sinceSept. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pC-G418-YR
Plasmid#61767PurposeYeast recombinational cloning compatible Agrobacterium tumefaciens ternary vector containing nptII (neomycin phosphotransferase II) selectable marker on transfer DNA (TDNA).DepositorInsertsnptII gene
2 micron origin or replication and URA3 gene for S. cerevisiae
UseTernary vector for agrobacterium mediated transfo…TagsExpressionMutationPromotertrpC promoterAvailable sinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDRM166 LKB (Luciferase mKate2 Blast)
Plasmid#183502PurposeExpresses the firefly luciferase gene, the NLS-tagged mKate2 gene, and the blasticidin resistance gene joined by P2A linkers.DepositorInsertsFirefly Luciferase
mKate2
BSD
UseLentiviral and LuciferaseTagsP2A linker and SV40 NLS with GGS linkerExpressionMammalianMutationPromoterMND, MND (off Luc-P2A), and MND (off Luc-P2A-mKat…Available sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
MSCV-opEBNA2-IRES-GFP
Plasmid#220354PurposeExpresses EBV latent gene EBNA2 in mammalian cells (EBNA2 coding sequence was optimised for expression and carries a C-terminal 3xHA-tag)DepositorInsertopEBNA2 (EBNA-2 Epstein-Barr Virus (EBV) strain B95-8)
UseRetroviralTags3 x HA tagExpressionMammalianMutationcodon-optimised for expression in mammalian cellsPromoterAvailable sinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHEE401
Plasmid#71286PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter), Hyg resistanceDepositorInsertssgRNA scaffold
zCas9
UseCRISPR; Plant binary vectorTags3x FLAG and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterEC1.2 promoter and U6-26p Arabidopsis U6 gene pro…Available sinceJan. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCRI003-pGEM-LS-Bar-PgpdA-dSpCas9-VPR-TtrpC-LS
Plasmid#140196PurposeChromosomal integration of PgpdA-dSpCas9-VPR-TtrpC. Contains 1kb homology arms for Aspergillus nidulans and the bar gene for glufosinate selection. Filamentous fungi vector.DepositorInsertsdSpCas9-VPR
Bar
Homology arm (ChrIV_A_nidulans_FGSC_A4:2736011,2737053)
Homology arm (ChrIV_A_nidulans_FGSC_A4:2790295,2791327)
UseCRISPR and Synthetic Biology; Fungal genome integ…TagsVPR (VP64-p65-Rta) , NLSExpressionMutationPromoterPgpdA and PtrpCAvailable sinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
hum alpha ENAC promoter a25-a23
Plasmid#83427Purposepromoter reporter construct to test 5' flanking sequencesDepositorInserthuman aENaC gene 5' flanking seq + 55 nt of the 5' UTR for exon 1A (SCNN1A Human)
UseLuciferaseTagsLuciferaseExpressionMutationPromoteralpha ENACAvailable sinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)_CBh-Cas9-T2A-mcherry-P2A-Ad4E4orf6
Plasmid#64222PurposeExpression vector for sgRNA and for Expression of Cas9 linked via T2A to mCherry linked to the Ad4 E4orf6 gene via P2ADepositorInsertsCas9
sgRNA cassette
UseCRISPRTags3xFLAG, NLS, and T2A-mCherry-P2A-E4orf6ExpressionMammalianMutationPromoterCBh and U6Available sinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
U6-hGRIN2B-CAG-ps-SpCas9
Plasmid#102851PurposeA single-chain light-controllable dSpCas9 with pdDronpa1 domains for hGRIN2B gene editingDepositorInsertsp-hGRIN2B-sgRNA; dSpCas9; pdDronpa1 (GRIN2B S. pyogenes, Synthetic, Human)
UseCRISPRTags3X Flag and NLSExpressionMammalianMutationPromoterU6 promoterAvailable sinceNov. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiV_Neo_POU2F3_CR
Plasmid#122175PurposeLentiviral expression plasmid of human POU2F3 cDNA (CRISPR-resistant silent mutation) with neomycin resistance geneDepositorInsertPOU2F3 (POU2F3 Human)
UseLentiviralTagsExpressionMammalianMutation3 silent mutations for gRNA resistance (882g-c, 8…PromoterEFSAvailable sinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEMT-TPE2A-Mef2c-Tdtomato-Gata4-Tbx5
Plasmid#111818PurposeQuadcistronic construct: Co-express four genes by three 2A peptides -- T2A, P2A and E2ADepositorUseCloning intermediateTagsExpressionMutationPromoterAvailable sinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
1073A(HomeR1)=pBac-[Pol-γ35.HL-decPol-γ35-p10]-[U6-gRNA#1(Pol-γ35)]-[3xp3-GFP-SV40]-Pol-γ35.HR-[Opie2-dsRed-SV40]
Plasmid#159676PurposePlasmid provides the HomeR#1 gene drive element harboring a rescue, gRNA#1, and 3xP3-eGFP that can be integrated via pBac and inserted at Pol-γ35 site #1 via HDR.DepositorInsertpBac-[Pol-γ35.HL-decPol-γ35-p10]-[U6-gRNA#1(Pol-γ35)]-[3xp3-GFP-SV40]-Pol-γ35.HR-[Opie2-dsRed-SV40]
UseTagsExpressionInsectMutationPromoterAvailable sinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
p13xQUAS-ZsGreen-P2A, α-cry:mCherry
Plasmid#180480PurposeInducible gene expression vector p13xQUAS-ZsGreen-P2A, α-cry:mCherryDepositorInsert13x QUAS-ZsGreen-P2A
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)_CBh-Cas9-T2A-BFP-P2A-Ad4E4orf6
Plasmid#64220PurposeExpression vector for sgRNA and Cas9 linked via T2A to BFP linked to the Ad4 E4orf6 gene via P2ADepositorInsertsCas9
sgRNA cassette
UseCRISPRTags3xFLAG, NLS, and T2A-BFP-P2A-E4orf6ExpressionMammalianMutationPromoterCBh and U6Available sinceNov. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRosa26-1_CBh-Cas9-T2A-BFP-P2A-Ad4E1B
Plasmid#64219PurposeExpression vector for a sgRNA against the mouse Rosa26 locus and Cas9 linked via T2A to BFP linked to the Ad4 E1B55K gene via P2ADepositorInsertsCas9
sgRNA targeting ROSA26-1
UseCRISPRTags3xFLAG, NLS, and T2A-BFP-P2A-E1BExpressionMammalianMutationPromoterCBh and U6Available sinceMay 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHL-EF1a-SphcCas9-iP-A
Plasmid#60599PurposeExpresses human codon-optimized Cas9 (derived from Streptococcus pyogenes) and pruomycin resistance gene.DepositorInsertCRISPR Cas9
UseCRISPRTagsExpressionMammalianMutationCodon usage optimized for human usagePromoterAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-PHFF
Plasmid#100280PurposeExpression vector for phycocyanobilin (PCB) synthesis in mammalian cells.DepositorInsertMTS-PcyA-FLAG-P2A-MTS-HA-HO1-P2A-MTS-Myc-Fd-P2A-MTS-Fnr-T7 (synthetic genes)
UseTagsFLAG, T7 and Mitochondria-targeting sequence (MTS…ExpressionMammalianMutationAll genes are codon-optimized for expression in h…PromoterCAG promoterAvailable sinceSept. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
p13xQUAS-MCS, α-cry:mCherry
Plasmid#180481PurposeInducible gene expression vector p13xQUAS-MCS, α-cry:mCherryDepositorInsertMultiple cloning site
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceApril 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDN-D2irTNG4kwh
Plasmid#44722DepositorInsertspCMV-D2i promoter
htetR::NLS::EGFP
UseSynthetic Biology; Expression regulator/reporter;…TagsRabbit β-globin intron II and WPREExpressionMammalianMutationInitiator motif (Inr) displaced relative to pCMV-…PromoterpCMV-D2iAvailable sinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-Puro HLAG-2A-sgRNA
Plasmid#182551PurposeCas9 from S.pyogenes with 2A-Puro, and the 2A-sgRNA to targeting exon 2 of human HLA-G geneDepositorInserthSpCas9-2A-Puro-HLAG-2A-sgRNA
UseCRISPRTagsExpressionMammalianMutationPromoterCbhAvailable sinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pROSA26-Donor
Plasmid#60952PurposePorcine ROSA26 locus targetingDepositorInsertPorcine ROSA26 homologous ARM
UseGene targetingTagsNeo EGFPExpressionMutationPromoterAvailable sinceJan. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
LoxP2-Mb2Tomato-2A (SO240)
Plasmid#99614PurposeTo clone gene of interest downstream of LoxP2-Mb2Tomato-2A cassetteDepositorInsertMb2Tomato
UseTagsT2AExpressionMammalianMutationPromoterAvailable sinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
LoxP1-Mb2YFP-2A (SO244)
Plasmid#99613PurposeTo clone gene of interest downstream of LoxP1-Mb2YFP-2A cassetteDepositorInsertMb2EYFP
UseTagsT2AExpressionMammalianMutationPromoterAvailable sinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
LoxP1-His-H2B-Cherry-2A (SO290)
Plasmid#99616PurposeTo clone gene of interest downstream of LoxP1-His-H2B-Cherry-2A cassetteDepositorInsert6xHis-H2B-Cherry
UseTagsT2AExpressionMammalianMutationPromoterAvailable sinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
LoxP2-H2B-EGFP-V5-2A (SO107)
Plasmid#99617PurposeTo clone gene of interest downstream of LoxP2-H2B-EGFP-V5-2ADepositorInsertH2B-EGFP-V5
UseTagsT2AExpressionMammalianMutationPromoterAvailable sinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
MLM3739
Plasmid#49959PurposeExpresses a mutant TALE-TET1CD (inactive catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene for use as a controlDepositorInsert3x Flag Tet1CDmut HB-4 (HBB Human)
UseTALENTags3x FLAGExpressionMutationcatalytic domain of TET1 inactive (H1671Y and D16…PromoterEF1aAvailable sinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
U6-hGRIN2B-CAG-ps-SaCas9
Plasmid#102853PurposeA single-chain light-controllable dSaCas9 with pdDronpa1 domains for hGRIN2B gene editingDepositorInsertsa-hGRIN2B-sgRNA; dSaCas9; pdDronpa1 (GRIN2B Synthetic, Human, S. aureus)
UseCRISPRTags3X Flag and NLSExpressionMammalianMutationPromoterU6 promoter;Available sinceNov. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
LoxP3-HA-H2B-Cerulean-2A (SO104)
Plasmid#99618PurposeTo clone gene of interest downstream of LoxP3-HA-H2B-Cerulean-2ADepositorInsertHA-H2B-Cerulean
UseTagsT2AExpressionMammalianMutationPromoterAvailable sinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
MLM3720
Plasmid#49944PurposeExpresses a mutant TALE-TET1CD (inactive catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene for use as a controlDepositorInsert3x FLAG Tet1CDmut RH-3 (RHOXF2 Human)
UseTALENTags3x FLAGExpressionMutationcatalytic domain of TET1 inactive (H1671Y and D16…PromoterEF1aAvailable sinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
LoxP3-Mb2-HA-mTFP1-2A (SO157)
Plasmid#99615PurposeTo clone gene of interest downstream of LoxP3-Mb2-HA-mTFP1-2ADepositorInsertMb2-HA-mTfp1
UseTagsT2AExpressionMammalianMutationPromoterAvailable sinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR-v2-Blast-Puro
Plasmid#167186PurposeLentiviral expression of sgRNA with blasticidin and puromycin resistance genesDepositorInsertBlasticidin S deaminase
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
iMb-Control-Mosaic (IR98.10)
Plasmid#99748PurposeRosa26 gene targeting vector to induce a Cre-dependent mosaic of cells expressing different fluorescent and marker proteins localized to the membraneDepositorInsertMbYFP, MbTomato, MbKate2
UseCre/Lox and Mouse TargetingTagsExpressionMammalianMutationPromoterAvailable sinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
MLM3709
Plasmid#49943PurposeExpresses a 3x Flag TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorInsert3x FLAG Tet1CD RH-3 (RHOXF2 Human)
UseTALENTags3x FLAGExpressionMutationPromoterEF1aAvailable sinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
pQFDBD-2x AD*-VP16*, α-cry:EGFP
Plasmid#180473PurposeGene expression vector pQFDBD-2x AD*-VP16*, α-cry:EGFPDepositorInsertQFDBD-2xQFAD*-VP16*
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
KI(GAPDH)-P2A-EGFP-CMV-NeoR
Plasmid#114009PurposeHDR-cassette to target chicken GAPDH gene for EGFP expression under control of the endogenous promoter. The cassette contains NeoR gene for positive clone selection and DTA gene for negative selectionDepositorInsertsUseTagsExpressionMammalianMutationPromoter-, CMV, and endogenous promoter (chicken GAPDH in…Available sinceJan. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
MLM3743
Plasmid#49962PurposeExpresses a mutant TALE-TET1CD (inactive catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene for use as a controlDepositorInsert3x Flag Tet1CDmut HB-5 (HBB Human)
UseTALENTags3x FLAGExpressionMutationcatalytic domain of TET1 inactive (H1671Y and D16…PromoterEF1aAvailable sinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only