Skip to main content

We narrowed to 9,135 results for: Pol

Showing: 1621 - 1640 of 9135 results
  1. pCAS

    Plasmid
    #60847
    Purpose
    Expresses S. pyogenes Cas9 plus an HDV ribozyme-sgRNA for genome editing in yeast
    Depositor
    Inserts
    S. pyogenese Cas9
    RNA pol III promoter (tRNA-Tyr)
    hepatitis delta virus ribozyme, genomic
    sgRNA
    Use
    CRISPR and Synthetic Biology
    Tags
    NLS/His8 and TTT 3' extension prior to sgRNA
    Expression
    Bacterial and Yeast
    Mutation
    L4 is UUCG tetraloop and guide targets LYP1 (CATA…
    Available Since
    Jan. 13, 2015
    Availability
    Academic Institutions and Nonprofits only
  2. pLKO.1-TRC.mKO2_shARL4C.1

    Plasmid
    #110320
    Purpose
    TRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2
    Insert
    ARL4C (ARL4C Human, Homo sapiens)
    Use
    Lentiviral and RNAi
    Expression
    Mammalian
    Promoter
    RNA polymerase III promoter for human U6 snRNA fo…
    Available Since
    Aug. 20, 2018
    Availability
    Academic Institutions and Nonprofits only
  3. pLKO.1-TRC.mKO2_shHRASLS.2

    Plasmid
    #110324
    Purpose
    TRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2
    Insert
    HRASLS (PLAAT1 Human, Homo sapiens)
    Use
    Lentiviral and RNAi
    Expression
    Mammalian
    Promoter
    RNA polymerase III promoter for human U6 snRNA fo…
    Available Since
    June 20, 2018
    Availability
    Academic Institutions and Nonprofits only
  4. pLKO.1-TRC.mKO2_shHRASLS.1

    Plasmid
    #110323
    Purpose
    TRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2
    Insert
    HRASLS (PLAAT1 Human, Homo sapiens)
    Use
    Lentiviral and RNAi
    Expression
    Mammalian
    Promoter
    RNA polymerase III promoter for human U6 snRNA fo…
    Available Since
    June 20, 2018
    Availability
    Academic Institutions and Nonprofits only
  5. pcDNA3.1_ spike_del19

    Plasmid
    #155297
    Purpose
    Expression of spike with C-term deletion of 19 aa, used to generate high efficiency SARS-CoV-2-pseudotyped lentiviral particles
    Insert
    SARS-Cov2 spike_deleted (S SARS-Cov2)
    Use
    Generation of sars-cov-2-pseudotyped lentiviral p…
    Mutation
    Deletion in C-term 19 aa of spike
    Promoter
    CMV
    Available Since
    Aug. 5, 2020
    Availability
    Industry, Academic Institutions, and Nonprofits
  6. pHIPH4

    Plasmid
    #117685
    Purpose
    Hansenula polymorpha expression plasmid
    Depositor
    Insert
    Alcohol Oxidase promoter
    Expression
    Yeast
    Promoter
    Alcohol Oxidase
    Available Since
    Jan. 7, 2019
    Availability
    Academic Institutions and Nonprofits only
  7. pETM41-EcPPK

    Plasmid
    #38334
    Depositor
    Insert
    E. coli polyphosphate kinase (ppk Escherichia coli)
    Tags
    6xHIS, MBP, and TEV
    Expression
    Bacterial
    Promoter
    T7
    Available Since
    Aug. 10, 2012
    Availability
    Academic Institutions and Nonprofits only
  8. pKM263-EcPPK

    Plasmid
    #38333
    Depositor
    Insert
    E. coli polyphosphate kinase (ppk Escherichia coli)
    Tags
    6xHIS, GST, and TEV
    Expression
    Bacterial
    Promoter
    T7
    Available Since
    Aug. 2, 2012
    Availability
    Academic Institutions and Nonprofits only
  9. pcDKIER

    Plasmid
    #37093
    Depositor
    Insert
    KI polyomavirus early region (KPV_gp4, KPV_gp5 KI polyomavirus)
    Expression
    Mammalian
    Promoter
    CMV
    Available Since
    July 3, 2012
    Availability
    Academic Institutions and Nonprofits only
  10. GE-0010-gRNA2-MpCKB

    Plasmid
    #238528
    Purpose
    Plant expression of Cas9 and gRNA against M. polymorpha CK2 beta
    Depositor
    Insert
    MpCKB
    Use
    CRISPR
    Expression
    Plant
    Available Since
    June 27, 2025
    Availability
    Academic Institutions and Nonprofits only
  11. GE-0010-gRNA1-MpCKB

    Plasmid
    #238527
    Purpose
    Plant expression of Cas9 and gRNA against M. polymorpha CK2 beta
    Depositor
    Insert
    MpCKB
    Use
    CRISPR
    Expression
    Plant
    Available Since
    June 27, 2025
    Availability
    Academic Institutions and Nonprofits only
  12. GE-0010-gRNA1-MpCKA

    Plasmid
    #238526
    Purpose
    Plant expression of Cas9 and gRNA against M. polymorpha CK2 alpha
    Depositor
    Insert
    MpCKA
    Use
    CRISPR
    Expression
    Plant
    Available Since
    June 27, 2025
    Availability
    Academic Institutions and Nonprofits only
Showing: 1621 - 1640 of 9135 results