We narrowed to 14,252 results for: sta
-
Plasmid#117161PurposeTarget site TTTAAGTTCCACAGACTTGGADepositorInsertshRNA targeting miR30
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_shRNA resistant nmPKA-Cα-mEGFP
Plasmid#114144PurposeThe G2A mutant of the mouse PKA catalytic subunit α C-terminally tagged by monomeric mEGFP. Silent mutations were introduced to make it resistant to shRNA knock-down.DepositorInsertmouse PKA Cα-mEGFP with G2A mutation and silent mutation to resist shRNA knockdown (Prkaca Mouse)
ExpressionMammalianMutationG2A mutation and silent mutation to resist shRNA ā¦Available SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTALE-STAR-T_RFP entry
Plasmid#87526PurposeDestination vector for domain insertionDepositorTypeEmpty backboneUseSynthetic Biology and TALEN; Tale empty functionaā¦Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTALE-STAR-A_RFP entry
Plasmid#87527PurposeDestination vector for domain insertionDepositorTypeEmpty backboneUseSynthetic Biology and TALEN; Tale empty functionaā¦Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTALE-STAR-C_RFP entry
Plasmid#87528PurposeDestination vector for domain insertionDepositorTypeEmpty backboneUseSynthetic Biology and TALEN; Tale empty functionaā¦Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTALE-STAR-G_RFP entry
Plasmid#87529PurposeDestination vector for domain insertionDepositorTypeEmpty backboneUseSynthetic Biology and TALEN; Tale empty functionaā¦Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET30-SBL1(160S,HisTagDel)
Plasmid#66880PurposeExpresses a version of pET30Xa-SBL1(160S) with 41 bp Histag removedDepositorInsertsoybean lipoxygenase-1 (S160S)
TagsnoneExpressionBacterialMutationnonePromoterT7lacAvailable SinceAug. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET30-SBL1(160E,HisTagDel)
Plasmid#66879PurposeExpresses a version of pET30Xa-SBL1(160E) with 41 bp Histag removedDepositorInsertsoybean lipoxygenase-1 (S160E)
ExpressionBacterialMutationS160EPromoterT7lacAvailable SinceAug. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEGFP C1 SADBs shRNA Resistant
Plasmid#67155PurposepEGFP containing N-terminally EGFP Tagged mouse SADBs resistant to an shRNADepositorInsertBrsk1 (Brsk1 Mouse)
TagsEGFPExpressionMammalianMutationnucleotide 294 C-T, nucleotide 297 C-GPromoterCMVAvailable SinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSG5 N-HA SADBs shRNA resistant
Plasmid#67157PurposeN-terminally HA tagged mouse SADBs containing substitutions providing resistance to an shRNADepositorInsertBrsk1 (Brsk1 Mouse)
TagsHAExpressionMammalianMutationNucleotide 294 C-T Nucleotide 297 C-G (shRNA resiā¦PromoterSV40 promoterAvailable SinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBACgus_Sumostar/LRRK2 1867-2141
Plasmid#40390DepositorInsertsUseBaculovirusTags6xHis and HisTEVMutationaa1867-2141PromoterpolHAvailable SinceOct. 1, 2012AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBACgus_Sumostar/LRRK2 1867-2161
Plasmid#40391DepositorInsertsUseBaculovirusTags6xHis and HisTEVMutationaa1867-2161PromoterpolHAvailable SinceOct. 1, 2012AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBACgus_Sumostar/LRRK2 1867-2161_G2019S
Plasmid#40393DepositorInsertsUseBaculovirusTags6xHis and HisTEVMutationaa1867-2161, G2019SPromoterpolHAvailable SinceOct. 1, 2012AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCMV-scFv-GCN4-StayGold-IRESv4-HaloTag-tdMCP-CAAX
Plasmid#241144PurposeExpresses Anti-GCN4 scFv-StayGold, and HaloTag-tdMCP-CAAX to track mature and nascent HA-tagged proteins and track MS2-tagged mRNA anchored to the plasma membraneDepositorInsertsAnti-GCN4 scFv
tdMCP - CAAX
Tags(n2)oxStayGold(c4) E147D and HaloTagExpressionMammalianPromoterCMVAvailable SinceSept. 3, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pHAGE-IRES-puro-NLS-HyperdLbCas12a-StayGold-NLS-3xFlag
Plasmid#236368PurposeOverexpression of HyperdLbCas12a in human cellsDepositorInsertHyperdLbCas12a
UseCRISPR and LentiviralMutationD156R, D235R, E292R, D350RAvailable SinceJuly 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-H2B-mStayGold-WPRE (JDW 1384)
Plasmid#242550PurposeGateway middle entry clone containing H2B-mStayGold with WPRE at the 3' end; Nuclear green fluorescent reporterDepositorInsertmStayGold (monomeric StayGold)
UseGateway CloningAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
LV_EF1a_Stat3(A662C,N664C,V667L)-P2A-Hygro_Barcode
Plasmid#170254PurposeBarcoded lentiviral vector to express Stat3 (A662C, N664C, V667L) in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seqDepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGB3 omega1 Tnos:BASTA:Pnos - P35S:hCas9:Tnos (GB3469)
Plasmid#160647Purposemodule containing the human codon optimized Cas9 and the BASTA selection markerDepositorInsertBASTA / Cas9
UseCRISPR and Synthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromoterPnos, P35SAvailable SinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
Zebrafish aBb crystallin 2kb promoter/AcGFP
Plasmid#98099PurposeZebrafish aBb crystallin 2kb promoter segment driving GFP expressionDepositorInsertAlpha Bb-crystallin promoter 2 kb fragment, Danio rerio (cryabb Zebrafish)
UseGfp expressingTagsGFPPromoterDanio alpha Bb-crystallin 2 kb fragment (-2092/-1)Available SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only