We narrowed to 5,431 results for: U6
-
-
-
-
pJPS2957
Plasmid#135591PurposeSNR6 has GAGAUUUAUUUC at position 96–107 deletedDepositorInsertsnR6 (snR6 Budding Yeast)
ExpressionYeastMutationU6Δ12 has GAGAUUUAUUUC at position 96–107 deletedPromoterNativeAvailable SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pXPR_016
Plasmid#107143PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and Hygro resistance from EF-1a promoter. 3rd generation lentiviral backbone.DepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
lenti-EGFR-L858R-T790M-dual-epegRNA
Plasmid#214100PurposeLentiviral vector expressing epegRNAs for the induction of EGFR L858R and T790M mutations, through tandem U6 expression of the two epegRNAs using independent U6 promoters.DepositorInsertEGFR L858R epegRNA/EGFR T790M epegRNA
UseLentiviralExpressionMammalianPromoterhU6Available SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJZC34
Plasmid#62331PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2(wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSIL-eGFP
Plasmid#52675PurposeshRNA silencing plasmid with eGFP transfection markerDepositorTypeEmpty backboneUseRNAiTagsCMV-EGFPPromoterCMV and U6Available SinceJune 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
PEA1-GFP
Plasmid#171993PurposeDelivers all prime editing nickase components in a single, GFP selectable plasmidDepositorInsertCbH-Cas9(H840A)-RT-T2A-GFP, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
ExpressionMammalianPromoterCMV for Cas9, U6 for gRNAsAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV-U6gRNA-EF(BbsI)-PGKpuro2ABFP
Plasmid#62348PurposeAn empty optimized gRNA expression vectorDepositorInsertnone
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only
