173,457 results

#158646

Lentiviral shRNA vector targeting simian virus 40 T antigen (SV40Tag)

Kevin Janes

Lopacinski et al Cell Syst. 2021 Apr 21;12(4):304-323.e13

Oct. 1, 2020

Academic Institutions and Nonprofits only

#70717

Expresses DREADDs Gq receptor under oxytocin promoter control

Daniel Geschwind

Penagarikano et al Sci Transl Med. 2015 Jan 21;7(271):271ra

Jan. 22, 2016

Academic Institutions and Nonprofits only

#179659

Tobacco Vein Mottling Viral Protease

Xiaojing Gao

Vlahos et al Nat Commun. 2022 Feb 17;13(1):912. doi:

March 23, 2022

Academic Institutions and Nonprofits only

#211398

mammalian expression of human Mcm2 C-terminally fused to mVenus

Helmut Pospiech

Jan. 16, 2024

Academic Institutions and Nonprofits only

#190240

Expresses iDREADD fused to mCherry flanked by DIO

Young J Yoon

Nasrallah et al Proc Natl Acad Sci U S A. 2022 Aug 9;119

Oct. 27, 2022

Academic Institutions and Nonprofits only

#87399

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#54567

Localization: N1 Cloning Vector, Excitation: 568, Emission: 592

Michael Davidson

Shaner et al Nat Methods. 2008 Jun;5(6):545-51. doi:

July 2, 2014

Academic Institutions and Nonprofits only

#51920

Expresses full-length Integrin beta-1 precursor ectodomain in mammalian cells. Stop codon before C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.

Gavin Wright

Sun et al Mol Cell Proteomics. 2015 Feb 23. pii: m

Feb. 27, 2015

Academic Institutions and Nonprofits only

#232871

Expresses OSBP in mammalian cells

Pietro De Camilli

Wang et al Nat Cell Biol. 2025 May;27(5):776-789. d

June 18, 2025

Academic Institutions and Nonprofits only