We narrowed to 899 results for: Gcat
-
Plasmid#75504Purpose3rd generation lentiviral gRNA plasmid targeting human BCKDKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAP215.rAAV.mU6-sgRNA.Handle.EF1a-mTagBFP2
Plasmid#217635PurposeAAV backbone for sgRNA expression. Contains a Lox-flanked handle sequence for Cre-dependent PCR amplification of sgRNAs. Protospacer is cloned between BstXI and BlpI.DepositorInsertmU6-sgRNA, Handle sequence, EF1a-mTagBFP2
UseAAVPromoterEF1alpha and mU6Available SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgCnr1
Plasmid#209196PurposeMutagenesis of Cnr1DepositorAvailable SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-shFMR1-mCherry
Plasmid#222963PurposeMake lentivirus to knock down human FMR1 geneDepositorInsertFMR1 shRNA (FMR1 Human)
UseLentiviralAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM gRNA (BRDN0001149518)
Plasmid#77529Purpose3rd generation lentiviral gRNA plasmid targeting human ATMDepositorAvailable SinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgCrebbp#1/Cre
Plasmid#193209PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Crebbp geneDepositorAvailable SinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgEp300#2/Cre
Plasmid#173592PurposeExpresses a Ep300-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Ep300 (Ep300 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
FGFR2 gRNA (BRDN0001147365)
Plasmid#76183Purpose3rd generation lentiviral gRNA plasmid targeting human FGFR2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only