We narrowed to 14,809 results for: mal.3

#168221

Mammalian expression of dTomato with 3 high affinity MS2 loops

Joshua Leonard

Hung et al J Extracell Vesicles. 2016 May 13;5:3102

Dec. 14, 2021

Academic Institutions and Nonprofits only

#136057

USP10 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CCTATGTGGAAACTAAGTATT)

Anthony Leung

Fischer et al Mol Cell. 2020 Apr 2;78(1):70-84.e6. doi

April 24, 2020

Academic Institutions and Nonprofits only

#221674

Expresses nLightG2-control in neurons

Tommaso Patriarchi

Rohner et al Nat Methods. 2026 Mar;23(3):636-652. doi

Feb. 26, 2026

Academic Institutions and Nonprofits only

#122099

AAV-mediated expression of Chronos-tdTomato under the EF1α promoter (1.1kb short version). tdTomato has codons varied to reduce recombination. Using SV40 pA signal.

Edward Boyden

Klapoetke et al Nat Methods. 2014 Mar;11(3):338-46. doi:

Aug. 15, 2019

Academic Institutions and Nonprofits only

#71213

dCas9 fused to BFP and the human DNMT3A catalytically inactive domain

Yonglun Luo

Lin et al Gigascience. 2018 Mar 1;7(3):1-19. doi:

June 20, 2018

Academic Institutions and Nonprofits only

#105811

Functional studies using RNAi; rescue experiments; substituting protein for its different form. miRNA cassette with nuclear EGFP expression marker; your protein of interest with C-terminal FLAG.

Andrzej Dziembowski

Szczesny et al PLoS One. 2018 Mar 28;13(3):e0194887. do

March 5, 2018

Academic Institutions and Nonprofits only

#105772

Expression of your protein of interest in fusion with blue fluorescent protein at the N-terminus (cleavable by TEV) (PMID: 18940671, 25378625). Useful for multi-channel live cell imaging.

Andrzej Dziembowski

Szczesny et al PLoS One. 2018 Mar 28;13(3):e0194887. do

Feb. 12, 2018

Academic Institutions and Nonprofits only