We narrowed to 9,512 results for: BLI;
-
Plasmid#136959PurposeReporter vector encoding firefly luciferase and TurboRFP fluorescent proteinDepositorInsertFirefly luciferase and TurboRFP
UseLentiviralTagsV5 tagPromoterCMVAvailable SinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-SspB-HaloTag-p63DH
Plasmid#176129PurposeHeterodimerization with iLID, RhoA activationDepositorInsertRHOGEF p63 (ARHGEF25 Human)
UseLentiviralAvailable SinceFeb. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-H3.3(WT)-3AID-HA-2A-mTurquoiseBSD
Plasmid#225701PurposeLentiviral expression of AID degron tagged Wildtype H3.3 and mTurquoise fused BlasticidinRDepositorUseLentiviralTags3xAID HA and T2A-mTurquoiseExpressionMammalianAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
GAG-CRErec
Plasmid#119971PurposeExpresses GAG (FMLV) fused with CRE recombinase for the production of VLPs loaded with CRE proteinDepositorInsertGAG-nlsCRErec
TagsnlsExpressionMammalianPromoterhCMVAvailable SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-3xsgRNA_Opn1mw-RHO-Cas9N-IntN-polyA
Plasmid#165450PurposeExpress N-terminal part of split dCas9-VPR and 3 sgRNAs targeting murine Opn1mw promoterDepositorInsertsdCas9N-IntN
3x Opn1mw promoter-targeting sgRNAs
UseAAV and CRISPRExpressionMammalianPromoterU6 and short human rhodopsin promoterAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
SSpB-iRFP-p63DH
Plasmid#176120PurposeHeterodimerization with iLID, RhoA activationDepositorInsertRHOGEF p63 (ARHGEF25 Human)
ExpressionMammalianAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UBC-FLEX-XRI-FLAG
Plasmid#178057PurposeExpression Recording Islands (XRIs) for recording cellular physiological histories along intracellular protein self-assembly. Contains XRI subunit with FLAG tag, under UBC promoter with a FLEX switch.DepositorInsertXRI-FLAG
UseAAVTagsFLAG-MBPExpressionMammalianPromoterHuman ubiquitin C (UBC) promoterAvailable SinceOct. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
FLAG-HA-FbxO11-ΔFbox-pcDNA3.1-
Plasmid#52502Purposeexpresses human FbxO11-ΔFbox in mammalian cells with FLAG-HA tag at N-terminusDepositorInsertFbxO11 (FBXO11 Human)
TagsFLAG-HAExpressionMammalianMutationdeletion of Fbox (deleted aa 71-116)PromoterCMVAvailable SinceJuly 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only