We narrowed to 6,914 results for: crispr cas9 plasmids
-
Plasmid#196255PurposePlasmid for cloning the 4th CRISPR-Cas9 guide RNA of 4 guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
BPK2301
Plasmid#65778PurposeHuman expression plasmid for S. thermophilus 1 Cas9 sgRNA (need to clone in spacer into BsmBI sites): U6-BsmBIcassette-St1-sgRNADepositorInsertSt1Cas9 gRNA backbone, without spacer sequence
UseCRISPRExpressionMammalianPromoterU6Available SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pORFE1001
Plasmid#112079PurposeOverexpression of the AtCAS9 in plant under 2x35S promoterDepositorInsertAtCAS9
UseCRISPRExpressionPlantMutationPlant codon optimized Cas9 S. pyogenesPromoter2x35SAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX552
Plasmid#60958PurposepAAV-U6sgRNA(SapI)_hSyn-GFP-KASH-bGH (SpGuide acceptor). AAV plasmid for sgRNA cloning. GFP-KASH fusion facilitates FACS sorting of cells and nuclei.DepositorInsertsU6_(SpaI)_sgRNA
Syn_EGFP-KASH
UseAAV, CRISPR, and Mouse TargetingExpressionMammalianPromoterSynapsin and U6Available SinceNov. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pU6-BbsI-chiRNA
Plasmid#45946PurposePlasmid for expression of chiRNA under the control of the Drosophila snRNA:U6:96Ab promoter.DepositorInsertU6-BbsI-chiRNA
UseCRISPRExpressionInsectPromoterDm-snRNA:U6:96AbAvailable SinceJune 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
MSP2443
Plasmid#72252PurposeHuman expression plasmid for SpCas9-VRQR-HF1 variant: CMV-T7-humanSpCas9-VRQR-HF1(N497A, R661A, Q695A, Q926A, D1135V, G1218R, R1335Q, T1337R)-NLS-3xFLAGDepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 VRQR-HF1(N497A/R661A/Q695A/Q926A/D1135V/G1218R/R1335Q/T1337R)-NLS-3xFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, Q926A, D1135V, G1218R, R1335…PromoterCMVAvailable SinceJan. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSP2440
Plasmid#72250PurposeHuman expression plasmid for SpCas9-VQR-HF1 variant: CMV-T7-humanSpCas9-VQR-HF1(N497A, R661A, Q695A, Q926A, D1135V, R1335Q, T1337R)-NLS-3xFLAGDepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 VQR-HF1(N497A/R661A/Q695A/Q926A/D1135V/R1335Q/T1337R)-NLS-3xFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, Q926A, D1135V, R1335Q, and T…PromoterCMVAvailable SinceJan. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCBC-DT1T2
Plasmid#50590PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT1, U626t plus, U629p, T2
UseCRISPR; Pcr templateExpressionPlantAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCBC-DT2T3
Plasmid#50591PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT2, gRNA scaffold, U6-29t plus, U6-1p, T3
UseCRISPR; Pcr templateExpressionPlantAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCBC-DT3T4
Plasmid#50592PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT3, gRNA scaffold, U6-1tplus, U6-26p, T4
UseCRISPR; Pcr templateExpressionPlantAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
PX458_ZNF3_1
Plasmid#72363PurposeEncodes gRNA for 3' target of human ZNF3 along with Cas9 with 2A GFPDepositorInsertZNF3 (ZNF3 Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458_ZNF3_2
Plasmid#72364PurposeEncodes gRNA for 3' target of human ZNF3 along with Cas9 with 2A GFPDepositorInsertZNF3 (ZNF3 Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Reckleen_3plus_sgRNA_ptet_pos4
Plasmid#233459PurposeLevel 1 part, Ptet sfgfp dropout sgRNA for position 4, for building RECKLEEN plasmid with multiple sgRNAsDepositorInsertLevel 1 part, Ptet sfgfp dropout sgRNA for position 4, ColE1 ori, and KanR.
UseCRISPRAvailable SinceApril 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
Reckleen_3plus_sgRNA_ptet_pos5
Plasmid#233460PurposeLevel 1 part, Ptet sfgfp dropout sgRNA for position 5, for building RECKLEEN plasmid with multiple sgRNAsDepositorInsertLevel 1 part, Ptet sfgfp dropout sgRNA for position 5, ColE1 ori, and KanR.
UseCRISPRAvailable SinceApril 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
Reckleen_3plus_sgRNA_ptet_pos5a
Plasmid#233461PurposeLevel 1 part, Ptet sfgfp dropout sgRNA for position 5a, for building RECKLEEN plasmid with multiple sgRNAsDepositorInsertLevel 1 part, Ptet sfgfp dropout sgRNA for position 5a, ColE1 ori, and KanR.
UseCRISPRAvailable SinceApril 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
Reckleen_3plus_sgRNA_ptet_pos5a1
Plasmid#233462PurposeLevel 1 part, Ptet sfgfp dropout sgRNA for position 5a1, for building RECKLEEN plasmid with multiple sgRNAsDepositorInsertLevel 1 part, Ptet sfgfp dropout sgRNA for position 5a1, ColE1 ori, and KanR.
UseCRISPRAvailable SinceApril 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
Reckleen_3plus_sgRNA_ptet_pos5a2
Plasmid#233463PurposeLevel 1 part, Ptet sfgfp dropout sgRNA for position 5a2, for building RECKLEEN plasmid with multiple sgRNAsDepositorInsertLevel 1 part, Ptet sfgfp dropout sgRNA for position 5a2, ColE1 ori, and KanR.
UseCRISPRAvailable SinceApril 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
Reckleen_3plus_sgRNA_ptet_pos5b
Plasmid#233464PurposeLevel 1 part, Ptet sfgfp dropout sgRNA for position 5b, for building RECKLEEN plasmid with multiple sgRNAsDepositorInsertLevel 1 part, Ptet sfgfp dropout sgRNA for position 5b, ColE1 ori, and KanR.
UseCRISPRAvailable SinceApril 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
Reckleen_3plus_sgRNA_ptet_pos5b1
Plasmid#233465PurposeLevel 1 part, Ptet sfgfp dropout sgRNA for position 5b1, for building RECKLEEN plasmid with multiple sgRNAsDepositorInsertLevel 1 part, Ptet sfgfp dropout sgRNA for position 5b1, ColE1 ori, and KanR.
UseCRISPRAvailable SinceApril 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits