We narrowed to 311 results for: cas9 f cas9 r
-
Plasmid#236205Purposelentiviral expression of Cas9 and encodes CT47 sgRNA for CLEC12A deletionDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAi14-GFPNLS-MC
Plasmid#87114Purposeminicircle parental backbone plasmid including GFPNLS-pA knock-in donor and one cutting site for HITIDepositorInsertGFPNLSPpA
UseCRISPRPromoternEFAvailable SinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mTubb3
Plasmid#87116PurposeAAV backbone plasmid including GFP knock-in donor and Tubb3gRNA for HITIDepositorInsertU6-mTubb3sgRNA-GFP-EF1a-mCherryKASH-hGHpA
UseAAV and CRISPRAvailable SinceMarch 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAi14-luc-MC
Plasmid#87113Purposeminicircle parental backbone plasmid including luc-pA knock-in donor and one cutting site for HITIDepositorInsertLuciferase-SV40pA
UseCRISPR and LuciferaseAvailable SinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ai14-HITI
Plasmid#87117PurposeAAV backbone plasmid including GFPNLS-pA knock-in donor and Ai14gRNA for HITIDepositorInsertU6-Ai14sgRNA-GFPNLS-EF1a-mCherryKASH-pA
UseAAV and CRISPRAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
Tubb3gRNA-mCherry
Plasmid#87111Purposemouse Tubb3 target gRNA expression plasmid with CAGmCherryDepositorInsertMouse Tubb3 gRNA
UseCRISPRPromoterCAGAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ai14-luc
Plasmid#87118PurposeAAV backbone plasmid including luc-pA knock-in donor and Ai14gRNA for HITIDepositorInsertU6-Ai14sgRNA-Luciferase-nEF-GFPKASH-hGHpA
UseAAV, CRISPR, and LuciferaseAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA(backbone)-pCBh-Cre-WPRE-hGHpA-ITR
Plasmid#60229PurposeExpresses Cre recombinase from the Cbh promoter and one U6-driven sgRNA. AAV backbone with SapI spacer for sgRNA cloning.DepositorInsertssgRNA
Cre recombinase
UseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsCre-HAExpressionMammalianPromoterCBh and U6Available SinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA(LacZ)-pCBh-Cre-WPRE-hGHpA-ITR
Plasmid#60228PurposeExpresses Cre recombinase from the Cbh promoter and one U6-driven sgRNA control targeting LacZ. AAV backbone.DepositorInsertssgRNA
Cre recombinase
UseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsCre-HAExpressionMammalianPromoterCBh and U6Available SinceNov. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA(NeuN)-pCBh-Cre-WPRE-hGHpA-ITR
Plasmid#60227PurposeExpresses Cre recombinase from the Cbh promoter and one U6-driven sgRNA targeting the mouse gene NeuN. AAV backbone.DepositorInsertssgRNA
Cre recombinase
UseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsCre-HAExpressionMammalianPromoterCBh and U6Available SinceNov. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-rMERTK-HITI
Plasmid#87119PurposeGene correction donor AAV for RCS rat. AAV backbone plasmid including exon 2 of rat Mertk and rMertkgRNA for HITIDepositorInsertU6-rMertksgRNA-Mertk(intron1-2)-nEF-GFPKASH-pA
UseAAV and CRISPRAvailable SinceMarch 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
GUCY2F gRNA (BRDN0001145143)
Plasmid#77253Purpose3rd generation lentiviral gRNA plasmid targeting human GUCY2FDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GUCY2F gRNA (BRDN0001146166)
Plasmid#77255Purpose3rd generation lentiviral gRNA plasmid targeting human GUCY2FDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GUCY2F gRNA (BRDN0001145320)
Plasmid#77256Purpose3rd generation lentiviral gRNA plasmid targeting human GUCY2FDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GUCY2F gRNA (BRDN0001147943)
Plasmid#77254Purpose3rd generation lentiviral gRNA plasmid targeting human GUCY2FDepositorAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only