We narrowed to 1,631 results for: PTS;
-
Plasmid#128405PurposeExpress both AsCas12a and CRISPR arrays on single transcriptsDepositorInsertAsCas12a-Triplex
UseLentiviralExpressionMammalianAvailable SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCE048-SiT-Cas12a
Plasmid#128124PurposeExpress both AsCas12a and CRISPR arrays on single transcriptsDepositorInsertAsCas12a-Triplex
UseAAVExpressionMammalianAvailable SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pG-HIV-LRT
Plasmid#104592PurposeStandard for qPCRDepositorInsertHIV-1 late reverse transcripts
UseCloning vectorAvailable SinceJan. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCI108-SiT-Cas12a-[Cond]
Plasmid#128407PurposeConditionally express both AsCas12a and CRISPR arrays on single transcriptsDepositorInsertAsCas12a-Triplex
UseAAVExpressionMammalianAvailable SinceNov. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCI118-SiT-Cas12a-[Ind]
Plasmid#128406PurposeInducible expression of both AsCas12a and CRISPR arrays on single transcriptsDepositorInsertAsCas12a-Triplex
UseAAVExpressionMammalianAvailable SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDY380
Plasmid#182962PurposeAmp-resistant, low copy (p15A ori), E. coli 5'ptsI transcriptionally fused with GFP.DepositorInsertptsI
UseSynthetic BiologyTagsGFPAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY390
Plasmid#182963PurposeAmp-resistant, low copy (p15A ori), E. coli ptsI transcriptionally fused with GFP.DepositorInsertptsI
UseSynthetic BiologyTagsGFPAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
HDM_SARS2_Spike_del21_D614G
Plasmid#158762PurposeMammalian expression vector for expressing SARS-2 Spike with 21 aa del at C-terminus and pt mutation D to G at site 614DepositorInsertSARS2-Spike_del21_D614G (S Synthetic, Severe acute respiratory syndrome coronavirus 2)
ExpressionMammalianMutationdeleted amino acids 1257-1278, changed aspartic a…PromoterCMVAvailable SinceAug. 25, 2020AvailabilityAcademic Institutions and Nonprofits only