We narrowed to 6,915 results for: tac
-
Plasmid#227497Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 66kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-25kb-USF
Plasmid#227468Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 25kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-24kb-USP
Plasmid#227445Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 24kb Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-FLAG-Regnase-3-HA_full-length
Plasmid#222656PurposeMammalian expression vector to express full-length Regnase-3 tagged with FLAG at N-term and HA at C-termDepositorAvailable SinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57 mini-FLAG-HA-Regnase-3 WT
Plasmid#222651PurposeFor in vitro transcription of mouse Zc3h12c tagged with FLAG-HA at N-termDepositorAvailable SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
mCherry-C1-FKBPflex-ELL-CAAX
Plasmid#220076Purposean extra long linker attached to a CAAX domain with an mCherry tagDepositorInsertCAAX (HRAS Human)
ExpressionMammalianAvailable SinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gT28.13.hSyn.flex.H2B.RFP
Plasmid#170376PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 13. Cre-inducible expression of nuclear RFP.DepositorInsertCre inducible H2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_1_As
Plasmid#155057PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_2_As
Plasmid#155056PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_2_Lb
Plasmid#155052PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
VV017: Archaerhodopsin-3 w/ D95Q point mutation fused to eGFP
Plasmid#58490PurposeExpresses Arch(D95Q)-eGFP in mammalian cells as a fluorescent reporter of membrane voltageDepositorInsertArchaerhodopsin-3 w/ D95H point mutation fused to eGFP
UseLentiviralTagseGFPExpressionMammalianMutationChanged Aspartic Acid 95 to GlutaminePromoterUbiquitinAvailable SinceAug. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-A2UCOE-EF1a-iCasp9-P2A-HLA-E SCT-T2A-hCD55-E2A-neo-AAVS1
Plasmid#205444Purposehuman AAVS1-targeting plasmid for expression of human CD46, HLA-G SCT, CD47, and CD59DepositorInsertiCasp9-HLA-E SCT-hCD55
ExpressionMammalianPromoterEF1aAvailable SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pmiRGLO-Zc3h12a 3’UTR
Plasmid#222662PurposeLuciferase reporter vector containing mouse Zc3h12a 3'UTRDepositorAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-A2UCOE-EF1a-hCD46-P2A-HLA-G SCT-T2A-hCD47-E2A-hCD59-F2A-neo-AAVS1
Plasmid#205443Purposehuman AAVS1-targeting plasmid for expression of iCasp9, HLA-E SCT, human and CD55DepositorInserthCD46-HLA-G SCT-hCD47-hCD59
ExpressionMammalianPromoterEF1aAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-A2UCOE-EF1a-HSV TK-P2A-H2-Kb SCT-T2A-mCD47-E2A-mCD55-F2A-neo-AAVS1
Plasmid#205446Purposehuman AAVS1-targeting plasmid for expression of HSV TK, H2-Kb SCT, mouse CD47, and mouse CD55DepositorInsertHSV TK-H2-Kb SCT-mCD47-mCD55
ExpressionMammalianPromoterEF1aAvailable SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
AA0250-mCherry-2a-hM4D-nrxn1a rev
Plasmid#60544PurposeCo-expresses hM4Dnrxn and a red fluorescent label from a Cre-dependent virusDepositorInsertsUseAAV and Cre/LoxTags2xHAPromoterCAGAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-A2UCOE-EF1a-iCasp9-P2A-Crry-T2A-mCD59-E2A-Qa1 SCT-F2A-neo-AAVS1
Plasmid#205445Purposehuman AAVS1-targeting plasmid for expression of iCasp9, Crry, mouse CD59, and Qa1 SCTDepositorInsertiCasp9-Crry-mCD59-Qa1 SCT
ExpressionMammalianPromoterEF1aAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDsRed-importinα
Plasmid#119679PurposeExpresses DsRed-tagged human importinα in mammalian cellsDepositorInsertimportinα (KPNA2 Human)
TagsDsRedExpressionMammalianMutationContains amino acids 251-529PromoterCMVAvailable SinceSept. 13, 2019AvailabilityAcademic Institutions and Nonprofits only