We narrowed to 1,878 results for: BRE
-
Plasmid#176237PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176238PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ and 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-CMV-EGFP-PolB(K72A)-PAMmut-Hygro
Plasmid#176087PurposeEGFP fused to the N-terminus of POLB containing the mutation Lys72Ala, a mutation in the PAM site used by POLBKOg1 & a hygromycin resistance cassetteDepositorInsertPolB (POLB Human)
UseLentiviralTagsEGFPExpressionMammalianMutationMutation in Lys72 to Ala, and mutation in the PAM…PromoterCMVAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cn-VA-NHEJ1-S263E
Plasmid#141340PurposeLentiviral vector for expression of human NHEJ1-S263E in mammalian cellsDepositorInsertNHEJ1-S263E (NHEJ1 Human)
UseLentiviralTagsVA tag (3XFLAG-2XTEV-6XHis-2XStrep-Beacon)ExpressionMammalianMutationS263EPromoterCMVAvailable SinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cn-VA-NHEJ1-S263A
Plasmid#141341PurposeLentiviral vector for expression of human NHEJ1-S263A in mammalian cellsDepositorInsertNHEJ1-S263A (NHEJ1 Human)
UseLentiviralTagsVA tag (3XFLAG-2XTEV-6XHis-2XStrep-Beacon)ExpressionMammalianMutationS263APromoterCMVAvailable SinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast POLA1 ISCmut
Plasmid#160808PurposeExpress ISC mutant POLA1DepositorInsertPOLA1 ISCmut (POLA1 Human)
UseRetroviralMutationCodon optimized, C1354S, C1359S, C1377S, C1380SAvailable SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag GK2
Plasmid#20494DepositorAvailable SinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag DAK
Plasmid#20473DepositorAvailable SinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac CAG eGFP-PolQ10A-FLAG P2A-BLAST
Plasmid#249812PurposeExpresses the polymerase theta protein fused with N-terminal eGFP and C-terminal FLAG tag and mutated at serines 1289, 1482, 1486, 1488, 1493, 1555, 1563, 1628, 1635 and threonine 1755 into alaninesDepositorInsertPolymerase Theta (POLQ Human)
TagsFLAG and eGFPExpressionMammalianMutationserines 1289, 1482, 1486, 1488, 1493, 1555, 1563,…PromoterCAGAvailable SinceMarch 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
CMV-FOXC1-T2A-miRFP670
Plasmid#182336PurposeExpresses human FOXC1 and miRFP670 via T2A linker under control of a CMV promoter.DepositorInsertForkhead Box C1 (FOXC1 Human)
TagsInserted T2A-miRFP670 at 3' terminal of MCS.ExpressionMammalianPromoterCMVAvailable SinceApril 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-TRE3G-SOX2-3xHA-P2A-tagBFP
Plasmid#163701PurposeDox-inducible SOX2-3xHA HDR knock-in cassette into the AAVS1 locus with a tagBFP fluorescent marker linked by a self-cleaving P2A peptide.DepositorInsertsUseAAV and CRISPRTags3x-HA and P2A-tagBFPExpressionMammalianPromoterCAG and TRE3GAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR4 Ta-sro1 WWE-PARP
Plasmid#192548PurposepENTR plasmid Triticum aestivum sro1, amino acids 1-434, cultivar SR3, no stop codonDepositorInsertSIMILAR TO RCD ONE 1 (SRO1) WWE-PARP domains, cultivar Shanrong No. 3 (SR3)
UseGateway CloningAvailable SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1a-XRCC1-EGFP-T2A-Myc-POLB(PAMmut)
Plasmid#176139PurposeEGFP fused to the C-terminus of XRCC1, linked by T2A to N-terminus Myc-tagged POLB with a mutation in the PAM site used by POLBKO gRNA1 & a hygromycin resistance cassetteDepositorUseLentiviralTagsEGFP and MYCExpressionMammalianPromoterEF1AAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-XL1/BRCT1-Linker-eGFP
Plasmid#176084PurposeEGFP fused to the C-terminus of a XL1/BRCT1 domain & a hygromycin resistance cassetteDepositorAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cn-VA-NHEJ1-S262E/S263E
Plasmid#141342PurposeLentiviral vector for expression of human NHEJ1-S262E/S263E in mammalian cellsDepositorInsertNHEJ1-S262E/S263E (NHEJ1 Human)
UseLentiviralTagsVA tag (3XFLAG-2XTEV-6XHis-2XStrep-Beacon)ExpressionMammalianMutationS262E/S263EPromoterCMVAvailable SinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cn-VA-NHEJ1-S262A/S263A
Plasmid#141343PurposeLentiviral vector for expression of human NHEJ1-S262A/S263A in mammalian cellsDepositorInsertNHEJ1-S262A/S263A (NHEJ1 Human)
UseLentiviralTagsVA tag (3XFLAG-2XTEV-6XHis-2XStrep-Beacon)ExpressionMammalianMutationS262A/S263APromoterCMVAvailable SinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQC hKGA.S286A V5-His IRES G418
Plasmid#110391Purposeγ-Retroviral transfer vector for expressing glutminase isoform KGA (S286A), C-terminal V5-6xHis tags, IRES-driven Geneticin selection.DepositorInsertKGA glutaminase (GLS Human)
UseRetroviralTags6xHis and V5ExpressionMammalianMutationS286APromoterCMVAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
FLAG-GRP78-No UTRs Wild-Type (pcDNA3.1)
Plasmid#238429PurposeExpresses GRP78 Full Length without UTRs fused to the FLAG TagDepositorInsert78-kDa glucose-regulated protein (HSPA5 Human)
TagsFLAGExpressionMammalianMutationThe UTRs of the gene have been deleted.Available SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only