We narrowed to 170,466 results for: addgene
-
Plasmid#198049PurposeMoClo Golden Gate Level 1 Position 6. Overexpression cassette of Growth-Regulating Factor 4 (GRF4) plus GRF-Interacting Factor 1 (GRF4-GIF1). Improves in vitro wheat regeneration and transformation.InsertZmUbiP::TaGRF4-GIF1::NosT
UseSynthetic BiologyPromoterZea mays (maize) ubiquitin promoterAvailable SinceApril 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLB
Plasmid#11619PurposepLB is a modification of pLL3.7 (Addgene#11795). Genetic elements known to prevent epigenetic silencing were added.DepositorTypeEmpty backboneUseCre/Lox, Lentiviral, and RNAiTagsGFPExpressionMammalianPromotermouse U6Available SinceJuly 19, 2006AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-TagRFP-2A-BSD
Plasmid#167930PurposeLentiviral gRNA expression with TagRFP fluorescence and blasticidin selection marker.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6, EF1aAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
miReporter-PGK
Plasmid#82477PurposemicroRNA reporter relying on a bidirectional PGK promoter. Contains MCS downstream of H2B-mCherry and H2B-Citrine to insert miRNA binding sites. Contains a Hygromycin selection cassette.DepositorInsertH2B-mCherry and H2B-Citrine. HygroR
Available SinceSept. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
miReporter-CAG
Plasmid#82478PurposemicroRNA reporter relying on a bidirectional CAG-based promoter. Contains MCS downstream of H2B-mCherry and H2B-Citrine to insert miRNA binding sites. Contains a Hygromycin selection cassette.DepositorInsertH2B-mCherry and H2B-Citrine. HygroR
Available SinceFeb. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCW-eGFP
Plasmid#162823PurposeDoxycycline-inducible overexpression of eGFPDepositorInserteGFP
UseLentiviralExpressionMammalianMutationV163APromoterTet ONAvailable SinceFeb. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLVPRT-tTR-KRAB
Plasmid#11648PurposeTet-regulated (Tet-on) lentiviral vector for transgene (hPrion promoter) - OR - shRNA (H1 promoter when subcloned from pLVTHM (Addgene#12247)) - 2nd generationDepositorInserthPrion, GFP, tTR-KRAB, Tet-on
UseLentiviralExpressionMammalianAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ptet-RFP-shR-rtTA
Plasmid#35625PurposeTet-inducible AAV shRNA vector to test efficacy of shRNAs. Used in combination with pGFPns-reporter (Addgene plasmid #35626).DepositorTypeEmpty backboneUseAAV and RNAi; Tet inducibleExpressionMammalianPromoterPtetAvailable SinceApril 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
iMbody_pSANG10-3F
Plasmid#184496PurposeExpresses iMbody-6xHis-3xFLAG in BL21(DE3) bacteriaDepositorInsertiMbody
Tags3xFLAG, 6xHis, and pelB leaderExpressionBacterialAvailable SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
MXS_PGK::CreERT2-bGHpA
Plasmid#62444PurposeMXS_chaining vector with PGK::CreERT2-bGHpADepositorInsertcassette containing the tamoxifen inducible Cre recombinase with PGK Promoter
UseSynthetic BiologyAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRH2521
Plasmid#84380PurposeExpression of sgRNA from a imyc promoter (Pimyc)DepositorInsertsgRNA cloning site
UseCRISPRExpressionBacterialAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPE4max-Blasticidin
Plasmid#194905PurposeExpressing prime editing PE4max proteins, to work in conjunction with an epegRNA encoding plasmid or Circular Vector as described in the cited article.DepositorInsertBSD
ExpressionMammalianPromoterCMVAvailable SinceMarch 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
DHFR-TEV (integrating)
Plasmid#247218PurposePlasmid for genomic integration of DHFR-TEV into the YORWΔ22 locus of yeast cells.DepositorInsertDHFR-TEV
ExpressionYeastPromoterTEF2Available SinceNov. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBEVY-L
Plasmid#51226Purposebi-directional expression vector for yeast, constitutively active, LEU2 selectionDepositorTypeEmpty backboneExpressionYeastPromoterGPD/ADH1Available SinceMarch 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-shFAM134B
Plasmid#109013Purposeshort-hairpin knockdown of targeted geneDepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGH224_sgRNA_2xMS2_Puro
Plasmid#85413PurposehU6 driven sgRNA vector with 2xMS2 vectors with puro selectable markerDepositorInsertpuromycin resistance
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pIgnaviCas9
Plasmid#127595PurposeExpresses IgnaviCas9 in E. coliDepositorInsertIgnaviCas9
Tags6xHis Tag and Maltose binding proteinExpressionBacterialPromoterT7 promoterAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDIRE
Plasmid#26745DepositorInsertiCre expression cassette
UseCre/Lox; Flp/frtExpressionMammalianAvailable SinceJan. 10, 2011AvailabilityAcademic Institutions and Nonprofits only