We narrowed to 14,057 results for: SHI
-
Plasmid#177955PurposeTransient mammalian expression of codon optimized SARS-CoV-2 Nucleocapsid (M234I). Used for generating RNA packaging virus-like particles.DepositorAvailable SinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pLVE-FH-IN
Plasmid#70071Purpose2nd gen lentiviral vector. Cre-removable and tet/dox controllable expression of FLAG-HA-tagged transgene in mammalian cellsDepositorTypeEmpty backboneUseCre/Lox and LentiviralExpressionMammalianPromoterEF1alphaAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pXPA-fapO-RgTALsyn
Plasmid#100946PurposeExpression of Tyrosine Ammonia Lyase from constitutive GAP promoterDepositorInsertRgTALsyn
UseSynthetic BiologyExpressionBacterialMutationSilent mutation to remove internal NdeI site on T…PromoterGAP (Constitutive)Available SinceSept. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 HA-Arp8
Plasmid#19796DepositorAvailable SinceNov. 21, 2008AvailabilityAcademic Institutions and Nonprofits only -
pBAD-R-iLACCO1.1
Plasmid#208020PurposeBiosensor for intracellular L-lactateDepositorInsertR-iLACCO1.1
ExpressionBacterialAvailable SinceOct. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX Supt6h-SH2
Plasmid#46518DepositorInsertSupt6h (SUPT6H Human)
TagsGST and PreScissionExpressionBacterialMutationcontains amino acids 1317-1441PromoterTacAvailable SinceJuly 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAV10.K5
Plasmid#63210PurposepCACS backbone (Amp), LEU2, contains an RFP flanked by BsaI sites with CAGT & TTTT overhangs for TU assembly using yGG. Integration into YKL162C-A (NotI or BciVI).DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterial and YeastAvailable SinceFeb. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAV10.K4
Plasmid#63212PurposepCACS backbone (Amp), TRP1, contains an RFP flanked by BsaI sites with CAGT & TTTT overhangs for TU assembly using yGG. Integration into chrIXR: 387328-388330.DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterial and YeastAvailable SinceFeb. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-PGAM1_sgRNA2
Plasmid#201615PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertPGAM1 (PGAM1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only