We narrowed to 13,309 results for: sequence
-
Plasmid#174610PurposePiggyBack transposon expressing a fusion of a tandem minigene antigens in KRAS, BRAF and CMV fused to an endosomal targeting sequence and translationally linked to human truncated CD19DepositorInserthuman CD19, antigen minigene
ExpressionMammalianAvailable SinceOct. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hlbCas12a-Nlux
Plasmid#176240PurposepNOC episomal plasmid harboring the humanized lbCas12a gene sequence tagged with Nlux under the control of Ribi promoterDepositorInserthumanized lbCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferasePromoterRibosomal subunitAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
Sema7a-Fc-His
Plasmid#72175PurposeExpresses the extracellular region of the Sema7A protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
CCM2_wt_eGFP
Plasmid#208876PurposeExpress eGFP-CCM2 in mammalian cells.DepositorAvailable SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-HLA-Flag-natT1R2
Plasmid#113947Purposemammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of HLA class I histocompatibility antigen A-2 alpha chainDepositorInsertT1R2 (TAS1R2 Human)
TagsFLAG and Signal/leader sequence from HLA class I …ExpressionMammalianMutationresidues 22-839Available SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-rBrokenheart
Plasmid#203394PurposeAAV transfer plasmid containing a constitutive (non Cre-dependent) BrokenHeart construct: a piggyBac donor transposon interrupting tdTomato. Transposase activity rescues coding sequence.DepositorInsertBrokenheart
UseAAVExpressionMammalianPromoterEF1aAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR-DMD-Donor
Plasmid#60605PurposeKnock-in donor vector to insert Exon 44 in front of Exon 45 of human DYSTROPHIN (DMD)gene, include EF1a-hygromycin resistance cassette flanked by loxP sequences.DepositorInsertHygromycin resistant gene
UseKnock-in donor vectorExpressionMammalianAvailable SinceDec. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-dSaCas9-NLS-3xHA-3xSunTag_bGHpA
Plasmid#177345PurposeAAV expression of a catalytically inactive SaCas9 (dSaCas9) fused with three copies of SunTag sequence from Synapsin promoterDepositorInsertdead hSaCas9
UseAAV and CRISPRTags3x GCN4 peptide, 3xHA, and NLSExpressionMammalianMutationD10A, N580APromoterSynapsinAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
Chicken ArcLight A173
Plasmid#53615PurposeGenetically encoded voltage sensor ArcLight with improved kineticsDepositorInsertChicken ArcLight-A173
ExpressionMammalianMutationGg-VSP contains an R153Q mutation and an amino ac…PromoterCMVAvailable SinceAug. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJZC33
Plasmid#62330PurposesgRNA + 2x MS2 with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2 binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only