173,511 results
-
Plasmid#159295PurposeLentiviral vector expressing mCherry driven by human EF1a promoterDepositorInsertmCherry
UseLentiviralExpressionMammalianPromoterhuman EF1a promoterAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-(mNeonGreen)4-tDeg
Plasmid#129402Purpose(mNeonGreen)4-tDeg fluorogenic proteinDepositorInsert(mNeonGreen)-tDeg
ExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
AIMTOR T757
Plasmid#140828PurposeAIMTOR T757 contains a cytoplasmic mTOR Activity Reporter derived from hu ULK1 protein boxed between BRET-compatible entities (Ypet and Nanoluciferase) to measure mTOR activity in living cellsDepositorInsertAIMTOR T757 (ULK1 Human)
TagsNES Nuclear export signalExpressionMammalianMutationThe insert comprises only a small sequence of hum…Available SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcs2-ATF4uORF1-2-GFP-IRES-mCherry
Plasmid#226105PurposeATF4uORF1-2 stability reporter construct with deletion of SIFI degron helices 1&2 for transient expression in mammalian cells to read out activation of the integrated stress response (ISR)DepositorInsertatf4 (ATF4 Human)
TagsGFPExpressionMammalianMutationcontains uORF1-2 of ATF4, whose stability can ser…Available SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
Membrane mCherry
Plasmid#210470PurposePlasma membrane localizing mCherry using Human LCK proto-oncogene sequenceDepositorInsertLCK membrane mCherry (LCK Human, A.victoria, Synthetic)
UseSynthetic Biology; Sea urchin, mammal, zebrafishTagsmCherryAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-TagBFP-PuroR
Plasmid#80969PurposeCRISPaint gene taggingDepositorInsertTagBFP
UseGene taggingPromoternoneAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-BRX-eGFP-NLS
Plasmid#217534PurposeAAV vector to drive the expression of eGFP under the control of the 4xBRE regulatory element of SMAD1 and miniXon splicing casette transcription factor in vivoDepositorArticleInsertBMP reporter element and miniXon casette (Smad1 Mouse)
UseAAVExpressionMammalianPromoterBMP Reporter ElementAvailable SinceApril 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ2821 pPB: CAG-GID1-VPR-IRES-Puro-WPRE PGK-GAI-tagBFP-SpdCas9-ABI
Plasmid#84257PurposeExpresses Sp dCas9 and GA-inducible VPR for OR gate/diametric regulationDepositorInsertsGAI-tagBFP-Sp dCas9-ABI
GID1-VPR
UseCRISPR and Synthetic Biology; PiggybacTags2xNLS (SV40), ABI, GAI, GID1, HA tag, IRES-Puro, …ExpressionMammalianPromoterCAG and PGKAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
mTurquoise2-Giantin
Plasmid#129630PurposeIn vivo visualization of the Golgi apparatus (can be used for colocalization studies)DepositorInsertmTurquoise2-Giantin
ExpressionMammalianPromoterCMVAvailable SinceJan. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET-6xHis-(pos9)GFP
Plasmid#89247PurposeExpresses GFP with +9 theoretical charge in E.ColiDepositorInsertHis6-(pos9)-GFP
TagsHis6ExpressionBacterialPromoterT7Available SinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits only