-
Plasmid#99495PurposeTEV::meGFP::3XFlagDepositorInsertTEV::meGFP::3XFlag
UseTagsExpressionBacterialMutationPromoterAvailable sinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMLS292
Plasmid#73725PurposeSapTrap 2xNLS-mCherry + Cbr-unc-119 donor plasmidDepositorInsert2xNLS-mCherry + Cbr-unc-119
UseCRISPR and Cre/LoxTagsExpressionWormMutationPromoterAvailable sinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458_SSRP1_1
Plasmid#72371PurposeEncodes gRNA for 3' target of human SSRP1 along with Cas9 with 2A GFPDepositorInsertSSRP1 (SSRP1 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458_SSRP1_2
Plasmid#72372PurposeEncodes gRNA for 3' target of human SSRP1 along with Cas9 with 2A GFPDepositorInsertSSRP1 (SSRP1 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 RFP670
Plasmid#187646Purposelentiviral vector expressing RFP670 alongside Cas9 and an sgRNA cloning siteDepositorInsertRFP 670
UseLentiviralTagsRFP670 and sgRNA cloning siteExpressionMutationPromoterEFS (P2A)Available sinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX458_PBX2_1
Plasmid#72357PurposeEncodes gRNA for 3' target of human PBX2 along with Cas9 with 2A GFPDepositorInsertPBX2 (PBX2 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458_PBX2_2
Plasmid#72358PurposeEncodes gRNA for 3' target of human PBX2 along with Cas9 with 2A GFPDepositorInsertPBX2 (PBX2 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-CASANOVA
Plasmid#113036PurposeAAV vector for CASANOVA (AcrIIA4-LOV2 hybrid) expression in mammalian cells; enables optogenetic control of SpyCas9DepositorInsertCASANOVA (for CRISPR/Cas9 activity switching via a novel optogenetic variant of AcrIIA4)
UseAAV, CRISPR, and Synthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
BRCA2 A11.2 gRNA
Plasmid#90550Purpose3rd generation lentiviral gRNA plasmid targeting human BRCA2DepositorInsertBRCA2 (Guide Designation A11.2)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
BRCA2 A12.2 gRNA
Plasmid#90551Purpose3rd generation lentiviral gRNA plasmid targeting human BRCA2DepositorInsertBRCA2 (Guide Designation A12.2)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
MASTL B4.4 gRNA
Plasmid#90755Purpose3rd generation lentiviral gRNA plasmid targeting human MASTLDepositorInsertMASTL (Guide Designation B4.4)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSMART-sgRNA (Sp)
Plasmid#80427PurposeU6 promoter driven sgRNA expression plasmid. Annealed oligonucleotides encoding crRNA sequence are ligated into BbsI site.DepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterAvailable sinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
BB44_pmc.DonorR5.TS
Plasmid#199223PurposeDonor plasmid with CCR5 target sites for ITPN or HMEJ knock-in at the human CCR5 safe harbour locusDepositorInsertExpression unit for mCherry - monomeric derivative of DsRed fluorescent protein (Shaner et al., 2004)
UseGene targeting donor plasmidTagsExpressionMammalianMutationPromoterHuman PGK1 gene promoterAvailable sinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-EGxxFP-Cetn1
Plasmid#50717PurposeCetn1 genomic region was placed in pCAG-EGxxFP. Positive control for DSB mediated EGFP reconstitution.DepositorInsertCetn1 (Cetn1 Mouse)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
EZH2 E9.3 gRNA
Plasmid#90684Purpose3rd generation lentiviral gRNA plasmid targeting human EZH2DepositorInsertEZH2 (Guide Designation E9.3)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
DKC1 F1.3 gRNA
Plasmid#90652Purpose3rd generation lentiviral gRNA plasmid targeting human DKC1DepositorInsertDKC1 (Guide Designation F1.3)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
DKC1 F2.3 gRNA
Plasmid#90653Purpose3rd generation lentiviral gRNA plasmid targeting human DKC1DepositorInsertDKC1 (Guide Designation F2.3)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
EZH2 E10.3 gRNA
Plasmid#90685Purpose3rd generation lentiviral gRNA plasmid targeting human EZH2DepositorInsertEZH2 (Guide Designation E10.3)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only