We narrowed to 13,309 results for: sequence

#128344

pAAV encoding gRNA sequence for loss-of-function indels

Ryan Drenan

Peng et al Eur J Neurosci. 2018 May 19. doi: 10.111

July 19, 2019

Academic Institutions and Nonprofits only

#87392

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87395

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87396

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#112712

For tetracycline-inducible expression of bio-myc-NES-EGFP in mammalian cells

Daniel Schoenberg

Trotman et al J Biol Chem. 2018 Oct 26;293(43):16596-1

May 8, 2019

Academic Institutions and Nonprofits only

#72166

Expresses the extracellular region of the Sema6B protein (truncated at extracellular domain cleavage site; ie, short), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.

Woj Wojtowicz

Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 1

Feb. 29, 2016

Academic Institutions and Nonprofits only

#72170

Expresses the extracellular region of the Sema6D, isoform 4 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.

Woj Wojtowicz

Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 1

Feb. 29, 2016

Academic Institutions and Nonprofits only

#108026

Expresses enzymatically monobiotinylated full-length BMR1_03g04550 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.

Gavin Wright

Elton et al Int J Parasitol. 2019 Feb;49(2):115-125.

Oct. 12, 2018

Academic Institutions and Nonprofits only