Showing: 1 - 14 of 14 results
-
Plasmid#62009Purposemammalian expression of nuclear envelope transmembrane proteinDepositorInsertMS4A1
UseTagsmRFPExpressionMammalianMutationPromoterpgkAvailabilityAcademic Institutions and Nonprofits only -
-
LentiCRISPRv2-sgCD20
Plasmid#209749PurposeLentiviral transfer plasmid to express Cas9 and a gRNA targeting the human CD20 gene, MS4A1.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pCDH-kz-CD20-Puro
Plasmid#209759PurposeLentiviral transfer plasmid to express the CDS of the human CD20 gene, MS4A1.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-CD20-Puro
Plasmid#209755PurposeLentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1. Specifically, the variant 1 mRNA isoform.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-CD20-Puro
Plasmid#209756PurposeLentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1. Specifically, the variant 2 mRNA isoform.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-CD20-Puro
Plasmid#209757PurposeLentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1. Specifically, the variant 3 mRNA isoform.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1AUC-DelStem-CD20-Puro
Plasmid#209758PurposeLentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1; variant 1 mRNA isoform with mutations to disrupt the uORFs and the stem-loop within the 5'-UTR.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationMutations to disrupt the uORFs and the stem-loop …PromoterAvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailabilityAcademic Institutions and Nonprofits only -
pGEM-hu FceRI beta
Plasmid#8366DepositorInserthuman Fc epsilon RI beta cDNA (MS4A2 Human)
UseTagsExpressionBacterialMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pGEM-rat FceRI beta cDNA
Plasmid#8374DepositorInsertrat Fc epsilon RI beta chain (Ms4a2 Rat)
UseTagsExpressionBacterialMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pBJ1 neo-mo FceRI beta
Plasmid#8604DepositorInsertmouse Fc epsilon RI beta cDNA (Ms4a2 Mouse)
UseTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only
Showing: 1 - 14 of 14 results