We narrowed to 65 results for: c myc del 2
-
TypeBlog Post...bound to the C-terminal peptide. One of these C-terminal antibodies was Myc1-9E10 (aka anti-c-Myc [9E10])....probe the functions of the human c-Myc gene (Evan, et al. 1985). Myc was one of the earliest identified...noticed that Myc1-9E10 and the other C-terminal antibodies only recognized the human c-Myc protein and ...when Evan’s team generated their Myc antibodies. At first, anti-c-Myc [9E10] was just one of several new...Addgene.org Find recombinant anti-c-Myc [9E10] at Addgene Find plasmids with the myc-tag ...sequences within the middle of the human c-Myc protein or the C-terminus, Evan, et al. isolated six different...things! Myc1-9E10 and the Myc-tag today Since Munro and Pelham introduced the Myc tag to the world...
-
Antibodies 101: Epitope Tags
TypeBlog Post...monoclonal (M2) as well as a chimera (rabbit). Myc The Myc tag is a 10 amino acid peptide (EQKLISEEDL) derived...negatively charged and 1 positively charged amino acids. Myc tags are frequently used for western blot, flow cytometry... However, protein purification is not ideal with Myc, as low pH conditions are required during the purification...affect protein function. Fun fact: The antibody to Myc was developed in 1985 and is still the most prevalent...Addgene has you covered with monoclonal antibodies to Myc for all of these species. HA The HA tag is a 9 amino...availability Plasmids 101: Protein Tags Antibodies: Of Myc and Men ...Epitope tags are short peptides introduced at the N or C terminus of a protein that are bound by antibodies... -
pCXLE toolkit: Efficient episomal plasmid-based method to reprogram peripheral blood cells to iPSCs
TypeBlog Post...enhances iPSC generation as does replacing C-MYC with L-MYC [10, 11]. While the mechanisms underlying ...addition of an shRNA for P53 and replacing C-MYC with L-MYC in the episomal reprogramming cocktail by ... reprogramming factors- OCT3/4, SOX2, KLF4, and C-MYC [1]. For the derivation of clinical grade hiPSCs... that encoded six factors - OCT3/4, SOX2, KLF4, C-MYC, LIN28 and SV40 large T antigen (SV40LT). The method...pCXLE-hSK 27078 SOX2 and KLF4 pCXLE-hUL 27080 L-MYC and LIN28 pCXLE-hOCT3/4-shp53-F 27077 OCT3/4 and...direct reprogramming by transformation-deficient Myc. Proc Natl Acad Sci U S A, 2010. 107(32): p. 14152...blood are reprogrammed immediately after collection [2]. PBMCs display unique epigenetic signatures that ... -
Delivery Methods for Generating iPSCs
TypeBlog Post...Zhi Ying Chen, Robert C. Robbins, Mark A. Kay, Michael T. Longaker, and Joseph C. Wu. "A nonviral minicircle... viral particles that express oncogenes, such as Myc. Viral vectors also have the largest genomic footprint...transgenes is a concern as well, and reactivation of Myc or other oncogenes after differentiation has been...2010). Gene-delivery systems for iPS cell generation. Expert opinion on biological therapy, 10 2, 231-42....including reporters and RNAi) for: NANOG OCT4 SOX2 MYC KLF4 LIN28 Check out these plasmids if you’re interested...plasmid-based expression requires serial transfection of 1 or 2 plasmids that express the reprogramming factors of...for generating iPSCs by plasmid transfection where 2 of 11 clones tested had plasmid integration. Another... -
Plasmids for Stem Cell Research
TypeCollection...2015 Jul 16;162(2):412-24. Mikkelsen Lentivirus Human Expression of human Klf4, Oct4, c-Myc, and Sox2 as ...Aug 1;13(2):246-54. Dowdy Adenovirus Mouse Non-integrating expression of mouse Sox2, Oct4, c-Myc, and Klf4...Reprogramming factors for delivering synthetic mRNAs encoding human Klf4, Oct4, Sox2, c-Myc, and Lin28A to somatic...state using a cocktail of factors (Oct3/4, Sox2, c-Myc, and Klf4) that are known to maintain pluripotency...Doxycycline-inducible expression of human Oct4, Sox2, Klf4, and c-Myc from four separate lentiviral plasmids A drug-inducible...for the expression of human Oct4, Klf4, Sox2, and c-Myc Human Induced Pluripotent Stem Cells Produced Under... vector for the expression of human Oct4, Klf4, c-Myc, and Sox2 Integrative Analyses of Human Reprogramming... -
No Llamas Required - Synthetic Nanobodies Against Membrane Proteins
TypeBlog Post...protocol starts out with anti-Myc antibodies bound to an ELISA plate to capture Myc-tagged sybodies. Then, the...the expression vector pSb-Init, which attaches a Myc-tag and a His6-tag to the end of each sybody candidate...due to camelid high body temperature (37.2 - 39.2°C). The Seeger lab found a way around this by using ...select for optimal sybody candidates. Figure 2: Outline of the process for selection of sybodies ...identify and isolate sybodies targeting the SARS-CoV-2 Receptor Binding Domain found on the membrane-bound...Generation Toolbox kit. Find the Seeger lab's SARS-CoV-2 sybodies! References Geertsma ER (2013) FX Cloning...2020) Synthetic nanobodies targeting the SARS-CoV-2 receptor-binding domain. BioRxiv. https://doi.org... -
The Developmental Studies Hybridoma Bank: Over 25 Years of Antibody Sharing
TypeBlog Post...fluorescent proteins (GFP and YFP) and protein tags (c-MYC and HA). We have also created the Monoclonal Antibody...human transcription factors such as PAX7, PAX6, AP-2 alpha and ISLET-1. In addition, we distribute monoclonal... example through the use of less toxic adjuvants; 2) generating complex antibody chips that allow assessment...Studies Hybridoma Bank. Antibodies are the most widely used class of protein-binding reagents. In the ... -
Fluorescent Protein Guide: Subcellular Localization
TypeCollection...pTag-RFP-C-h-Rab5a-c-Myc Early endosomes Rab5a TagRFP James Johnson 79801 pTag-BFP-C-h-Rab5a-c-Myc Early ...pTag-RFP-C-h-Rab4a-c-Myc Recycling endosomes Rab4a TagRFP James Johnson 79799 pTag-BFP-C-h-Rab4a-c-Myc Recycling...-RFP-C-h-Rab11a-c-Myc Recycling endosomes Rab11a TagRFP James Johnson 79805 pTag-BFP-C-h-Rab11a-c-Myc ...dependent on cell cycle) Centrin-2 EGFP Erich Nigg 41151 pEGFP Cep170 C-term Centrioles (dependent on cell...pCMV-mGold-Tubulin-C-18 Microtubules alpha-tubulin mGold Francois St-Pierre 158009 pCMV-mGold-Actin-C-18 Actin ...Voeltz 73209 pcDNA3.1-kappa-myc-dL5-2XG4S-mCer3-KDEL Endoplasmic Reticulum KDEL dL5 FAP; mCerulean3 Marcel...Bruchez 73209 pcDNA3.1-kappa-myc-dL5-2XG4S-mCer3-KDEL Endoplasmic Reticulum KDEL dL5 FAP; mCerulean3 Marcel... -
Starter Guide to induced Pluripotent Stem Cells (iPSCs) Part 2: Reprogramming and Transdifferentiation
TypeBlog Post...four reprogramming factors- OCT4, SOX2, KLF4, and C-MYC - that induce a differentiated somatic cell to revert...additional pluripotency stage) Less Safety Less (C-MYC, a known oncogene is one of the reprogramming factors...methods. Some of the more common delivery methods include retrovirus [2], lentivirus [4], adenovirus [5...revert back to a pluripotent stage (iPSC formation) [2, 3]. The iPSCs then proliferate and redifferentiate...2006. 441(7097): p. 1061-7. PubMed PMID: 16810240. 2. Takahashi, K., et al., Induction of pluripotent stem... Pluripotent Stem Cells. Cell Stem Cell, 2015. 17(2): p. 178-94. PubMed PMID: 26189426. 15. Si-Tayeb, ...22645348. PubMed Central PMCID: PMC3390875. 25. Patsch, C., et al., Generation of vascular endothelial and smooth... -
Neurodegeneration Plasmid Collection
TypeCollection...pCMVTNT PINK1 N-myc PINK1 Myc CMV Parkinson's Mark Cookson 13314 pCMVTNT PINK1 C-myc PINK1 Myc CMV Parkinson's...Ultra-Exon1Q23-Myc-A HTT Myc UbC Huntington's Baoji Xu 110487 Ultra-Exon1Q145-Myc-A HTT Myc UbC Huntington's...pUltra-Exon1Q23-Myc-B HTT Myc UbC Huntington's Baoji Xu 110489 pUltra-Exon1Q145-Myc-B HTT Myc UbC Huntington's...Strep-Lrrk2-Myc LRRK2 Myc, Strep CMV Parkinson's Maik Hintze 161583 pPuro3.1(+)_Strep-Lrrk2-Myc LRRK2 Myc, Strep...LRRK2 Myc, Strep CMV Parkinson's Maik Hintze 161586 pPuro3.1(+)_Strep-Lrrk2(delKinase)-Myc LRRK2 Myc, Strep...LRRK2-WT LRRK2 His, Myc CMV Parkinson's Ted Dawson 17612 pRK5-Myc-Parkin PRKN Myc CMV Parkinson's Ted ... pGW1-Myc-DJ1-WT PARK7 V5 CMV Parkinson's Mark Cookson 29349 pGW1-Myc-DJ1-L166P/K130R PARK7 Myc CMV Parkinson's... -
Fluorescent Tagging of Endogenous Genes with SapTrap
TypeBlog Post... T2A-TurboGFP-PEST), and small epitope tags (HA, Myc, Strep tag II, AviTag, HaloTag, SpyTag). The Foerstemann...PCR or by evaluating visual phenotypes. Improving C. elegans fluorescent protein tagging with SapTrap ...called SapTrap to improve CRISPR genomic tagging in C. elegans. SapTrap offers scientists a convenient one...digestion of the destination vector with SapI yields 2 sites- the first site accepts the sgRNA target sequence...marker, and connector to be released (Fig. 1, Step 2-3). Since donor plasmids of the same type will produce...protein tagging systems For those who do not work with C. elegans, several groups have designed modular toolkits...by the Hornung Lab, allows users to easily create C-terminal tag fusions of endogenous genes in human ... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...display vector with a C-terminal Myc tag pPMW-attB - pUASp plasmid with N-terminal Myc tag and attB for Drosophila...N-terminal Myc tag for mammalian expression pGEX-4T-1-3xMyc - Bacterial vector for Myc tag pETcon(-) - Yeast...vector for C-terminal 3x HA tag fusion with your gene of interest in plants Myc Epitope tag pKMyc - N-terminal...transgenesis His Epitope tag pEZYmyc-His - C-terminal Myc-His tag for mammalian expression...backbone, mammalian expression pENTR4-myc-nuc - pEntry vector that adds a C-terminal nuclear localization signal...MCS-BioID2-HA or myc-BioID2-MCS - To fuse your protein of interest to the N-terminus or C-terminus of BioID2... Backbones Flag Epitope tag c-Flag pcDNA3 or FLAG-HA-pcDNA3.1 - C-terminal Flag or N-terminal FLAG-HA... -
Synthesized by Ginkgo Bioworks, Shared by Addgene: SARS-CoV-2 Plasmids for Many Expression Systems
TypeBlog Post...sites (thrombin and TEV), and C-terminal tags (StrepII, 3xFLAG, 6xHIS, MBP, Myc). These constructs include...Illustration of SARS-CoV-2 from Philippa Steinberg for the IGI. What SARS-CoV-2 plasmids from Ginkgo ...Bioworks to synthesize and share over 1,850 SARS-CoV-2 plasmids to help academic and industrial labs accelerate...request? Currently, plasmids containing all SARS-CoV-2 protein coding genes in E. coli and S. cerevisiae ...bacterial expression systems, Ginkgo synthesized SARS-CoV-2 expression plasmids in a high copy backbone with a...high level expression and purification of SARS-CoV-2 proteins for downstream experiments and offer flexibility...optimized, full length and truncated versions of SARS-CoV-2 S (spike protein) cloned into a CMV driven expression... -
Hot Plasmids: Spring 2025
TypeBlog Post...or add a versatile N- or C-terminal HA tag. Selectable and stable: A puromycin resistance gene makes stable...known regulators at the FOS gene promoter and the MYC locus (Figure 5). Figure 5: TurboCas protein...cell-attached recordings in primary visual cortex (V1) layer 2/3 (L2/3). B) Fluorescence from axonal boutons of neurons...expressing iGluSnFR3, iGluSnFR4f, and iGluSnFR4s. C) Spike-triggered averages for single action potential-evoked... generation and stable cell line creation (Figure 2). Looking for more? Explore our empty and EGFP retroviral... Lentiviral backbone plasmids here! Figure 2: Addgene cloned EGFP into pAG Lenti CMV N-HA Puro ...Glypicans are proteoglycans composed of a protein core, 2–4 glycosaminoglycans (GAG), and are (typically) tethered... -
15 Hot Plasmids from 2017
TypeBlog Post...transcription factors OCT3/4, SOX2, KLF4, and c-MYC is the established model for reprogramming somatic cells. A ...NGG) Editing window ~2 nt 85175 pBK-EE-BE3 SpCas9 (NGG) Editing window ~2 nt 85176 pBK-YE2-...deposited 2 Bacillus subtilis libraries with Addgene – the B. subtilis Single Gene Deletion Library—Kanamycin...article have been deposited with Addgene and include MYC- and FLAG-tagged TZAP constructs (wild-type and truncation...fluorophores with nonoverlapping emission spectra (N- and C-terminal tags for mTagBFP, TagRFPt, EGFP, mVenus, ...quantum yield of 0.54) and mScarlet-H with M164H (2-fold improvement in photostability compared to mScarlet...coselection, analogous to methods previously used in C. elegans, targets the sodium/potassium pump ATP1A1... -
Genomic Deletions in Mammalian Cell Lines
TypeCollection...: 95 °C for 15 min, 35 cycles of (95 °C for 30 sec, 60 °C for 1 min, 72 °C for 1 min), and 72 °C for 10...following parameters: 37 °C for 30 min; 95 °C for 5 min and then ramp down to 25 °C at 5 °C/min. Dilute oligos...parameters: Cycles 1-20 (37 °C for 5 min, 20 °C for 5 min); Cycle 21 (80 °C for 20 min). These cycling ...Incubate at 30 - 37 °C for 24 - 72 hr. 30 °C may enhance genome editing efficiency, but 37 °C is acceptable....clones. Run sample in thermocycler: 65 °C for 6 min and 98 °C for 2 min to extract gDNA. Screen each clone...genomic deletion. Run sample in thermocycler and run the following program: 65 °C for 6 min, 98 °C for 2... and H 2 O up to 20 μl. Use the primers designed in step 2 above. Conduct PCR for “non-deletion band” ... -
Hassle-free 96-well Format Epitope Tagging Using Cas9 Ribonucleoprotein
TypeBlog Post...(3xFLAG, Myc, V5, or HA). Tag-specific PCR genotyping can tell if HDR completely failed. If C-terminus...purify IVT sgRNA in the lab. Figure 2: Cas9 RNP complexed with 2-part cr:tracrRNA tags genes more effectively...Kalantzaki M, Gangoso E, Matjusaitis M, Garcia-Diaz C, Blin C, Grant V, Bulstrode H, Gogolok S et al. 2017. ...genomes only and deals with C-terminus epitope tagging. If you work with other model systems, you will have...let cells recover for 2-5 days.Note: We use the Nucleofection method for delivery of csRNP reagents into...into stem cells. Cells are allowed to recover for 2-5 days and then analyzed for tagging efficiency using...IVT sgRNA) approach (Dewari et al. 2018 and Figure 2). Not only is the cr:tracrRNA approach highly efficient... -
Starter guide to induced pluripotent stem cells (iPSCs) part 1: A renaissance in regenerative medicine
TypeBlog Post... of four embryonic genes- OCT4, SOX2, KLF4, and C-MYC. iPSCs were first generated from mouse fibroblasts...them in Regenerative Medicine. Acta Naturae, 2010. 2(2): p. 18-28. PubMed PMID: 22649638. PubMed Central...capability to differentiate into specialized cell types [2]. We general speak of 4 levels of stem cell potency...zygote through to the morula stage are totipotent [2-4]. Pluripotency: When a cell has the ability to differentiate...stem cells (ESCs), which I discuss in detail below [2]. Multipotency: When a cell can differentiate into...PMID: 26726264. PubMed Central PMCID: PMC4686367. 2. Jaenisch, R. and R. Young, Stem cells, the molecular...differentiate into multiple cell types makes them useful models for developmental processes and promising therapeutic... -
Luciferase Plasmid Collection
TypeCollection...five transcriptional reporters for NF-kb, TGF-b, c-Myc, p53, and MAPK/JNK plus a constitutive control. ...fusing NanoLuc® and Venus fluorophore to Troponin C Ca 2+ binding domain. Luminopsins : Luciferase-opsin...Mammalian expression of Nanoluc with a N-terminal Myc tag Erich Wanker 124701 pLenti-PGK-Venus-Akaluc (...Lentiviral expression of Nanoluc with a N-terminal Myc tag Erich Wanker 115352 pFL-SV40 Firefly SV40 Mammalian...87075 pLenti6.2-ccdB-Nanoluc NanoLuc® Creation of C-terminal Nanoluc fusions using Gateway cloning. Lentival...Alberto Macho 174051 pGWB-cLUC Firefly Creation of C-terminal Fifrefly luciferase fragment for split-luciferase...transfection Feng Zhang 21471 pLenti PGK V5-LUC Neo (w623-2) Firefly PGK Lentiviral expression of firefly luciferase... -
Prime Editing: Adding Precision and Flexibility to CRISPR Editing
TypeBlog Post...j.cell.2021.09.018 Choi, J., Chen, W., Suiter, C. C., Lee, C., Chardon, F. M., Yang, W., Leith, A., Daza,...expression ~ ~ ~ ~ ✓ ✓ SV40 and c-Myc nuclear localization sequences Improve translocation..., J., Oyler-Castrillo, P., Ravisankar, P., Ward, C. C., Levesque, S., Jing, Y., Simpson, D., Zhao, A.,...editing efficiencies 2-3-fold. However, the process of double nicking increases indel formation slightly...). Precise genomic deletions using paired prime editing. Nature Biotechnology, 40(2), 218–226. https:/...Leukemia Virus (M-MLV) reverse transcriptase to the C-terminus of Cas9 H840A nickase (PE1). But innovations... editing as efficient as possible. Figure 2: Decision tree for selecting a PE6 variant. PE = prime... -
Neuronal labeling with Spaghetti Monster
TypeBlog Post...hemagglutinin (HA), myelocytomatosis viral oncogene (myc), simian virus 5-derived epitope (V5), the synthetic...experiment using smFPs and standard neuronal tracers. 2. Visualization of neuronal sub-cellular structures...similar proteins. For example, N-cadherin (cadherin-2) is a postsynaptic cell adhesion protein that plays...PMID: 25915120. PubMed Central PMCID: PMC4573404. 2. Shepherd, G.M. (2004). In "The synaptic organization...pdb-top63. PubMed PMID: 20150100. 4. Shaner, Nathan C., George H. Patterson, and Michael W. Davidson. "Advances...recombinant Adeno-associated virus (AAV) has been widely used to deliver genetic tools to the brain because of its...together with the development of methodologies to deliver genes to the CNS have recently made it much easier... -
Hot Plasmids February 2024
TypeBlog Post...Figure 1: A) Cell-penetrating Cas9, fused to HIV TAT, Myc and SV40 Nuclear Localization Signals, and GFP. B...mChe), with co-incubation with assist peptide (AP). C) Workflow for Cas-RNP-PAGE editing of primary T cells...overview of these new variants: Figure 2: Inner mitochondrial membranes imaged with structured...non-invasive systemic gene delivery in non-human primate (NHP) brains. Systemic gene delivery capsids previously...transfer in primate brains Endothelial-specific AAV delivery Recombinant anti-FLAG tag antibodies Peptide-assisted...addressed this problem by optimizing the Cas protein delivery with Peptide-Assisted Genome Editing (PAGE). They...due to its long, negatively charged sgRNA), RNP delivery was much better with Cas12, which uses a much ... -
CRISPR Pooled gRNA Libraries
TypeCollection...plasmid) 73633 (2 plasmid) Knockout Mouse Doench and Root 3rd 4 78,637 Broad GPP Humagne Set C and Humagne...Humagne Set D 172650 (Set C) 172651 (Set D) Knockout Human Doench and Root 2nd 2 40,710 Inzolia Human CRISPR...3rd 1, 2, or 4 49,766 arrays Broad GPP kinome Brunello 75314, 75315 (1 plasmid) 75312, 75313 (2 plasmid...Knockout Library 171531 Knockout Human Li 3rd ~6 9,274 MYC-CRISPR Library 173195 Knockout Human Dzikiewicz-Krawczyk...gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources ...pneumoniae M. tuberculosis M. smegmatis Green monkey ( C. sabaeus ) Kaposi's Sarcoma-associated Herpes Virus...GPP genome-wide Brunello 73179 (1 plasmid) 73178 (2 plasmid) Knockout Human Doench and Root 3rd 4 76,441... -
Tetracycline Inducible Expression
TypeCollection...opens in a new window) Krueger, C., Pfleiderer, K., Hillen, W., & Berens, C. (2004). Tetracycline derivatives...inducible expression of mouse Oct4, Sox2, Klf4, and Myc for iPS cell generation Rudolf Jaenisch 51543 FUW-tetO-hOKMS...inducible expression of human Oct4, Sox2, Klf4, and Myc for iPS cell generation Tarjei Mikkelsen 172115 PB-TO-hNGN2...vector to express Tet-On 3G transactivator under the c-Fos promoter Tet-On 3G rtTA Bong-Kiun Kaang 20342 ...hSyn promoter rtTA3 Wei Xu 26803 pEnt L1L3 EF1a-tTA-2 Gateway entry vector to express tTA from EF1α promoter... N., Schambach, A., Galla, M., Maetzig, T., Baum, C., Loew, R., & Schiedlmeier, B. (2011). Retroviral ...expression and improved dynamic range . Hum Gene Ther, 22 (2), 166–176. https://doi.org/10.1089/hum.2010.099 (Link... -
28 Hot Plasmid Technologies from 2015
TypeBlog Post... Cas9 into n-terminal (Cas9(N)-2xNLS) and c-terminal (Cas9(C)-2xNLS) fragments facilitates target DNA ...activation, the c-terminal cas9 fragment was fused with FK 506 binding protein 12 (Cas9(C)-FKBP-2xNLS) and...many types of epitope tags (eg. HA, MYC, Flag), they can be deleterious and cause aberrant protein folding...export sequence. Treatment with rapamycin induces Cas9(N)-FRB-NES and Cas9(C)-FKBP-2xNLS dimerization and... with shRNA or shRNA-miR30, (2) tamoxifen-inducible CreERT2 gene deletion, (3) simultaneous expression...them to popularly used epitopes tags such as HA and MYC in vivo. The authors found that fusions to one particular...an n-terminal DNA recognition domain and a mostly c-terminal nuclease domain. Feng Zhang's group utilized... -
Five Popular Model Organisms
TypeBlog Post...an ortholog in C. elegans making it ideal to study basic molecular biology processes. C. elegans are also...PMCID: PMC5525645. Mello, Craig C., et al. "Efficient gene transfer in C. elegans: extrachromosomal maintenance...variety of environmental conditions, and double every 2 hours. Yeast are also the first eukaryotic genome ...lab to study neuronal development (Brenner, 1973). C. elegans are small, transparent worms that have a ...life cycle and large brood sizes. The majority of C. elegans are also self-fertile hermaphrodites making... Nobel Prize in 2006. One of major advantages of C. elegans is that they are transparent throughout their...GCaMP6 (Nguyen et al., 2015). If you are interested in C. elegans plasmids and resources check out Addgene’... -
CRISPR 101: Cytosine Transversion Editors
TypeBlog Post...transversions C → TG → A A → GT → C C → G C → AG → C G → T A → C ...Rosser, S. J., Bi, C., & Zhang, X. (2021). Glycosylase base editors enable C-to-A and C-to-G base changes...deaminase could also perform cytidine (C) deamination, converting the C base to uracil (U). This is the same...given the pithier name CGBE1, for “C → G Base Editor 1,” and had a C → G editing efficiency of up to 68%...Beyond UNG: Optimizing C → G editors Now that several labs had shown that preferential C → G editing was possible...pyrimidines (C ↔ T). Base transversion Base changes from purine (A or G) to pyrimidine (C or T) or vice-versa...type of base editor invented. CGBE C → G Base Editor Converts C → G; also called a glycosylase base ... -
Hot Plasmids: Fall 2024
TypeBlog Post...improve solubility and stability (Figure 2). Figure 2: Crystal structures of CRBNmidi alone... 228(2), iyae126. https://doi.org/10.1093/genetics/iyae126. Gene disruption in Mycobacterium abscessus...Optimized mScarlet-based tags for live imaging in C. elegans CRISPR/Cas9 for gene disruption in M. abscessus...tagging proteins, as it can be fused to the N- or C-terminus (or even in the middle of proteins) and performs.... E., Young, D. F., Goswami, K. K., & Russell, W. C. (1987). Isolation and characterization of monoclonal...39406745. Optimizing mScarlet tags for live imaging in C. elegans By Alyssa Neuhaus Red fluorescent proteins...maturation rate limits its use in systems like the C. elegans embryo, where developmental processes happen... -
Validated gRNA Sequences
TypeCollection... Joung fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC...& Lim swan-2 C. elegans ACAAATTGATATCCAATCA 66100 cut S. pyogenes 25249454 Seydoux swan-2 C. elegans TGAAGAAAGTTATACTCGA...Yamamoto avr-14 C. elegans GATTGGAGAGTTAGACCACG 58981 cut S. pyogenes 24879462 Mello avr-15 C. elegans GTTTGCAATATAAGTCACCC...Katic dpy-10 C. elegans GCTACCATAGGCACCACGAG 59933 cut S. pyogenes 25161212 Fire dpy-10 C. elegans TCCGCTACCATAGGCACCA...Sabatini K08F4.2 C. elegans AATCACTCCCTGTTTGTGT 66085 cut S. pyogenes 25249454 Seydoux K08F4.2 C. elegans CACGAGGTGGTATGCGCAG...Seydoux K08F4.2 C. elegans CGCAGCGGTTTCCAAAATG 66092 cut S. pyogenes 25249454 Seydoux K08F4.2 C. elegans GCCTTAACCCAGAATAAGA...Mashimo Kit-2 R. norvegicus CTAACGTTCCAGCGCTCGTT 60970 cut S. pyogenes 24967838 Mashimo Kit-2 R. norvegicus... -
Plasmids 101: Repressible Promoters
TypeBlog Post...combined the system with Flp/FRT, as reviewed by del Valle Rodriguez et al. LexA/lexAop A second binary...Find plasmids from this publication at Addgene. del Valle Rodriguez, Alberto, Dominic Didiano & Claude...engineering applications in Saccharomyces cerevisiae.” FEMS Yeast Res. 12(2) (2012): 197-214. PubMed PMID...also shown that the Q system is also functional in C. elegans. Subsequent work by the Luo and Potter labs...immediate early gene expression. Genes Dev. 1988 Jun;2(6):718-29. doi: 10.1101/gad.2.6.718. PMID: 2843425...23995928; PMCID: PMC3811519.Seo SO, Schmidt-Dannert C. Development of a synthetic cumate-inducible gene ...Targeted Gene Expression in Drosophila.” Genetics 186(2) (2010): 735-55. PubMed PMID: 20697123. PubMed Central...