Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 919 results for: IRE;

Showing: 1 - 40 of 919 results

  1. Chemogenetics AAV Preps

    Type
    Collection
    ...GlyR IRES EGFP PSAM4 GlyR - Inhibition IRES EGFP none 5 Sternson 119744 AAV CAMKII PSAM4 GlyR IRES EGFP...pAAV-hSyn-dF-HA-KORD-IRES-mCitrine kappa-opioid receptor (KOR) - Inhibition IRES mCitrine Cre-dependent...pAAV-hSyn-DIO-HA-hM3D(Gq)-IRES-mCitrine hM3D(Gq) - Activation HA fusion and IRES mCitrine Cre-dependent ...pAAV-hSyn-DIO-HA-hM4D(Gi)-IRES-mCitrine hM4D(Gi) - Inhibition HA fusion and IRES mCitrine Cre-dependent ... 119741 AAV SYN flex PSAM4 GlyR IRES EGFP PSAM4 GlyR - Inhibition IRES EGFP Cre-dependent 5, 9 Sternson...pAAV-CaMKIIa-HA-hM4D(Gi)-IRES-mCitrine hM4D(Gi) - Inhibition HA fusion and IRES mCitrine none 2, 8 Roth...50472 pAAV-GFAP-HA-rM3D(Gs)-IRES-mCitrine rM3D(Gs) - Activation HA fusion and IRES mCitrine none 5 Roth 50478...

  2. Retrovirus Plasmids

    Type
    Collection
    ...20672 MSCV-IRES-GFP MSCV For transgene expression and GFP marker Reya 21654 pMSCV PIG (Puro IRES GFP empty...miRNA expression Chen 52114 pMSCV-IRES-mCherry FP MSCV A bicistronic IRES-mCherry containing retroviral plasmid...gene fused to eGFP expression Clevers 18760 MSCV IRES Luciferase MSCV Plasmid for transgene expression...

  3. Luciferase Plasmid Collection

    Type
    Collection
    ...Bartel 101139 pCMV-IRES-Renilla Luciferase-IRES-Gateway-Firefly Luciferase (pIRIGF) Firefly, Renilla Creating...Basic-IRES Firefly Insertion of 5' promoter/enhancer regions Joshua Mendell 60323 pGL4.23-GW Firefly Insertion... Groskreutz 18760 MSCV IRES Luciferase Firefly Retroviral expression of firefly luciferase and gene of...pHIV-Luciferase Firefly Lentiviral vector for insertion of your gene of interest upstream of IRES-firefly luciferase...pLenti-EF1a-Luciferase-IRES-Blast-WPRE Firefly EF1α Lentiviral expression of firefly luciferase Javier Alcudia...Luciferase-pcDNA3 Firefly CMV Mammalian expression of firefly luciferase William Kaelin 60495 pSBtet-GP Firefly TRE ...Lentiviral expression of firefly luciferase Christopher Vakoc 33307 Ubc.Luc.IRES.Puro Firefly Ubc Lentiviral expression...

  4. Recombinases AAV Preps

    Type
    Collection
    ...eGFP 1, 2, 5, 8, 9 Wilson 55632 pAAV-Ef1a-mCherry-IRES-Cre EF1a mCherry (not a fusion tag) 8, rg* Deisseroth... Syn none rg* Wickersham 55634 pAAV-EF1a-mCherry-IRES-Flpo EF1a mCherry (not a fusion tag) 1, rg* Deisseroth...

  5. AAV for Neuronal Tracing

    Type
    Collection
    ...Rabies and Neuronal Tracing References Wickersham IR, Finke S, Conzelmann KK, Callaway EM. 2007a. Retrograde...Nat Methods. 4(1):47-9. PMID: 17179932 Wickersham IR, Lyon DC, Barnard RJ, Mori T, Finke S, Conzelmann... the viral glycoprotein (G) gene, which is not required for the transcription or replication of the genome...genome within infected cells, but is required for transynnaptic spread (Wickersham et al., 2007a, Wickersham...envelope protein of (EnvA) of leukosis virus. EnvA can direct virus infection specifically into cells that express...

  6. Deisseroth INTRSECT Collection

    Type
    Collection
    ...pAAV-Ef1a-mCherry-IRES-Cre None Yes 55637 pAAV-EF1a-Flpo None Yes 55634 pAAV-EF1a-mCherry-IRES-Flpo None Yes...double transgenic animal strategy (PV-2a-Cre; SOM-IRES-Flp). Image from Fenno et al., 2014. INTRSECT INTRSECT...55635 pAAV-EF1a-sCre None No 55633 pAAV-EF1a-mCherry-IRES-Dre None No 183535 pAAV-CaMKIIa-Flpo None No Single...these recombinase recognition sequences enables directional control of the portion of the ORF that is sandwiched...sandwiched between the sites; the starting direction of these ORF fragments (which have become exons) determines... determines the logical expression requirements of Cre and Flp (B,E). When the correct combinations of...

  7. Brain Initiative Collection

    Type
    Collection
    ...Prep Description PI 65417-AAV8 pAAV-hSyn-dF-HA-KORD-IRES-mCitrine AAV packaging vector for hSyn driven KOR...Hillel Adesnik 109048-AAV9 pAAV-CAG-DIO-NLS-mRuby3-IRES-eGtACR1-ST Anion channelrhodopsin GtACR1 fused to...Viviana Gradinaru 119741-AAV5 AAV SYN flex PSAM4 GlyR IRES EGFP Chemogenetics Cre-dependent expression plasmid...Scott Sternson 119741-AAV9 AAV SYN flex PSAM4 GlyR IRES EGFP Chemogenetics Cre-dependent expression plasmid...plasmid Scott Sternson 119742-AAV5 AAV SYN PSAM4 GlyR IRES EGFP Chemogenetics expression plasmid Scott Sternson...Sternson 119744-AAV5 AAV CAMKII PSAM4 GlyR IRES EGFP Chemogenetics expression plasmid Scott Sternson 123308...brain cells and circuits during behavior. Long desired by researchers, the revolutionary dynamic picture...

  8. Viral Production

    Type
    Collection
    ...cells were transduced with either pAAV-Ef1a-mCherry-IRES-Cre (55634-AAVrg) alone at 1.7E6 viral genomes (...expression alone was detected. pAAV-Ef1a-mCherry-IRES-Cre was a gift from Karl Deisseroth (Addgene viral... Cre-dependent GFP expression was detected with direct fluorescence. GFP was not detected in the absence...

  9. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...to use, integrate into host genome MSCV-IRES-GFP or pMSCV-IRES-mCherry FP - Mammalian retroviral gene ...reporter gene with cap-dependent 3Myc-EYFP-HA-His6 and IRES-dependent ECFP-HA-His6 translation for mammalian...- Collection of plasmids from the Fire Lab L4440 - RNAi in C. elegans Also...segments of target genes can be inserted into this firefly luciferase reporter to test for their effects on...

  10. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...61727 mCherry-Parkin-IRES-zeo PRKN mCherry Parkinson's Stephen Tait 61728 YFP-Parkin-IRES-zeo PRKN YFP Parkinson's...107543 pAAV-AICD-NLS-IRES-hrGFP APP CMV Alzheimer's Helene Marie 107544 pAAV-AICD-NES-IRES-hrGFP APP V5 CMV...pLV-EF1a-KIF5A-HA-IRES-Puro KIF5A HA eF1a ALS Rosalind Segal 166953 pLV-EF1a-KIF5AR280H-HA-IRES-Puro KIF5A HA... MSCV-Fbxo7-IRES-GFP FBXO7 GFP Parkinson's Heike Laman 171787 MSCV-Fbxo7(deltaF-box)-IRES-GFP FBXO7 GFP... pAAV-hSyn-GFP-IRES-mSNCA SNCA GFP hSyn Parkinson's Jun Ding 185715 pAAV-hSyn-GFP-IRES-hSNCA SNCA GFP ...pAAV-hSyn-GFP-IRES-mSNCA(1-95) SNCA GFP hSyn Parkinson's Jun Ding 185717 pAAV-hSyn-GFP-IRES-hSNCA (A11P/...pAAV-hSyn-GFP-IRES-hSNCA (S129A) SNCA GFP hSyn Parkinson's Jun Ding 185719 pAAV-hSyn-GFP-IRES-hSNCA (S129D...

  11. SARS-CoV-2 Pseudotyped Virus

    Type
    Collection
    .... pHAGE-CMV-Luc2-IRES-ZsGreen-W - Lentiviral dual reporter vector expressing firefly luciferase and ZsGreen... expressing firefly luciferase. pCMV-FLuc - Retroviral reporter vector expressing firefly luciferase. ... a Biosafety Level 3 (BSL-3) agent, SARS-CoV-2 requires specialized facilities for the study of the live...Lentiviral dual reporter vector expressing mCherry and firefly luciferase. pLentiEGFPdestablized - EFS-EGFPd2PEST...Lenti-luciferase-P2A-Neo - Lentiviral reporter vector expressing firefly luciferase with neomycin resistance. Other Resources...

  12. Retrograde AAV viral preps

    Type
    Collection
    ...expression Recombinases Aebischer 55632 pAAV-Ef1a-mCherry-IRES-Cre EF1a Cre and physically-separate mCherry expression...expression Recombinases Wilson 55634 pAAV-EF1a-mCherry-IRES-Flpo EF1a Flpo and physically-separate mCherry expression...CamKII Bidirectional Optogenetics Wiegert 154951 hSyn-DIO-somBiPOLES-mCerulean Syn Bidirectional, Cre-dependent...Dopamine Optogenetics Activators Inhibitors Bidirectional DREADDs Activators Inhibitors Other Molecular...

  13. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...removed to increase the cloning capacity. pCDH-CB-IRES-copGFP-T2A-Puro 72299 Express gene of interest from...

  14. Ras Pathway

    Type
    Collection
    ...receptor INSRR Insulin receptor-related receptor IRS IRS1 IRS2 Insulin receptor substrate JUN Jun proto-oncogene...

  15. Control AAV Preps

    Type
    Collection
    ...Constitutive 1 Deisseroth 105921 pAAV-CBh-mKate2-IRES-MCS (WT-WT) CBh mKate2 Constitutive 2 Patrick 114469...

  16. Optogenetics AAV Preps

    Type
    Collection
    ...dependent 5 Yizhar 109048 pAAV-CAG-DIO-NLS-mRuby3-IRES-eGtACR1-ST CAG eGtACR1 (soma-targeted) mRuby3 Cre...variants Jaws WiChR stGtACR iC++ OPN3 PdCO PPO Bidirectional BiPOLES Promoter CAG CaMKII CBA Dlx EF1a/nEF...

  17. Tetracycline Inducible Expression

    Type
    Collection
    ... or Off) None Tight TRE Markus Ralser 64238 pTet-IRES-EGFP Lentiviral plasmid for Tet-controlled expression...transduction (transient or stable) may depend on the desired sensitivity, level of induction, or amount of background... TRE, miniCMV Maria Lung 16542 pBI-MCS-EGFP Bidirectional promoter (Pbi) for Tet-responsive expression...

  18. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...Mammalian U6 yes, cut S. pyogenes Kuehn pMCS-rybozyme-IRES-CAS9 64668 Mammalian yes, cut S. pyogenes W Fujii...Protocols gRNA Design Tools CRISPR Blog Posts CRISPR requires that you have to express both a Cas protein and... plasmids that do not co-express a Cas protein require a separate plasmid that does so; however, these...these independent gRNA plasmids can be paired with a wide variety of plasmids and therefore are not limited...Apramycin Zhao pRB1017 59936 Worm BsaI none S. pyogenes Fire pGL3-U6-sgRNA-PGK-Puro 51133 Mammalian none S. pyogenes...expression of multipe gRNAs. Csy4 cleavable cassettes; requires expression of Csy4 (eg Plasmid 53369 ). Joung ...

  19. Plasmids 101: Multicistronic Vectors

    Type
    Blog Post
    ...MSCV-IRES-EGFP IRES Retroviral pMSCV-pBabeMCS-IRES-RFP IRES Retroviral pMSCV-IRES-YFP II IRES Retroviral...pCMMP-MCS-IRES-Puro IRES Retroviral pEF1a-IRES-Neo IRES Mammalian MSCV-IRES-Luciferase IRES Retroviral...instead of an IRES when stoichiometrically equivalent levels of expression are required, we should also...plasmids for research purposes are described below. IRES Elements Translation in eukaryotes usually begins... element called an Internal Ribosome Entry Site (IRES) to allow for initiation of translation from an ...mRNA. In the figure above, you can see that the IRES element acts as another ribosome recruitment site...co-expression of two proteins from a single mRNA. IRES was originally discovered in poliovirus RNA, where...

  20. Site Directed Mutagenesis by PCR

    Type
    Blog Post
    ...homology-directed repair (HDR) of a CRISPR/Cas9 induced double-stranded break. This site-directed genome...using primers (with the desired mutation) in a PCR protocol that amplifies the entire plasmid template. The...for the desired modification. Finally, the positive clones are sequenced to confirm the desired modification...template for site directed mutagenesis.  Polymerase To ensure that you don’t introduce undesired mutations through...Kristian Laursen from Cornell University. Site directed mutagenesis is a highly versatile technique that...also highly relevant in this age of CRISPR; site-directed mutagenesis generally applies to plasmids, but...genome editing requires a template of high homology to the endogenous target, yet to facilitate the repair...

  22. CRISPR 101: Homology Directed Repair

    Type
    Blog Post
    ...post, we will describe the mechanism of homology directed repair, one of the repair pathways of DSBs, with...genome modification purposes. How does homology directed repair fix DNA double-strand breaks?  In eukaryotic...Non-Homologous End-Joining (NHEJ) and Homology Directed Repair (HDR). NHEJ is the canonical homology-independent...-independent pathway as it involves the direct ligation of sticky or blunt ends and often introduces small...This will serve as both a substrate for proteins required for strand invasion and a primer for DNA repair...resolve to complete the DNA repair process Homology directed repair pathways HDR mechanisms can be divided ...an error prone mechanism that notably does not require a donor template and thus won’t be covered in detail...

  23. Antibodies 101: Antibody Engineering and Directed Evolution

    Type
    Blog Post
    ...Structure-guided directed evolution If you desire a bit more control, structure guided directed evolution might... with BioRender.com.   Antibody directed evolution Directed evolution is a method employed to rapidly...antibody-based therapeutics. Whether antibodies are used directly as therapeutic agents or serve as vehicles for...technique we haven’t discussed in depth is antibody directed evolution. This is a larger process of gradually... primers, gene shuffling, and structure-guided directed evolution. The nice thing about these methods ... Figure 2: General process of antibody directed evolution. Created with BioRender.com.   ...strengths of rational design with the power of directed evolution, all while maintaining a higher degree...

  24. The PAM Requirement and Expanding CRISPR Beyond SpCas9

    Type
    Blog Post
    ...updated Aug 20, 2020. Cas9 can be used to modify any desired genomic target provided that (1) the sequence is...signal for Cas9 and this sequence is a strict requirement for Cas9-mediated DNA cleavage. The need for... may be unintentionally mutated along with the desired target locus. The PAM sequence is of particular...concern when trying to edit a gene using homology directed repair, since HDR-mediated gene editing is most...Cas13 enzymes are advantageous because they do not require a PAM, and RNA targeting is potentially reversible...since there is no genomic edit. Some Cas13 enzymes require a single base protospacer flanking sequence (PFS...

  25. CRISPR Challenges: Standardization and Homology Directed Repair

    Type
    Blog Post
    ...below. The complexity and challenges of homology directed repair (HDR) are echoed in the amount of interest...designing a repair template that contains your desired edit, and I want to make sure that I (and Addgene...out this RNP protocol on Protocols.io. The PAM Requirement and Expanding CRISPR Beyond SpCas9 The closer...

  26. Q&A With Julie Cicalese, the Newest Member of the Addgene Board of Directors

    Type
    Blog Post
    ...welcome Julie Cicalese to the Addgene Board of Directors. Cicalese served as the Chief Human Resource Officer...School. The addition of Cicalese to the Board of Directors brings human resources experience and insight ...me to join the committee because I had recently retired from Harvard, and it let me keep my toe in the ...little bit?”    What are you doing to enjoy your retirement? I’m also on the advisory board for Art in Giving... Meet the other members of Addgene's Board of Directors Find careers at Addgene ...

  27. No Llamas Required - Synthetic Nanobodies Against Membrane Proteins

    Type
    Blog Post
    ...  But llama immunization has its drawbacks: it requires a camelid animal facility which can be expensive...spike protein (Walter et al., 2020). No llamas required. The advantages of synthetic nanobodies Nanobodies... because they have fewer hydrophilic surfaces, require detergents or lipids to remain folded, and are ...regions that bind to the antigen. The Seeger lab can directly provide the three sybody libraries in the form...

  28. Phage Directory: From Phage Therapy to a Repository of Phage Information

    Type
    Blog Post
    ...search of phages for therapy Phage Directory started out as a directory of phage researchers and the phages...can be sent out to the directory earlier, but the researchers in the directory are volunteering their ...says. As the labs in the directory step forward to help, the Phage Directory team must decide which labs...). The pair quickly teamed up to create Phage Directory in a whirlwind three days in November 2017. ...find much-needed phages for patients.   A phage directory is crucial because it's hard to find the right...a last resort, so a request for phages to the directory does not typically come out until nearly the last... and information Since the inception of Phage Directory ~1 year ago, Sacher and Zheng found that they ...

  29. CRISPR 101: Cas9 Nickase Design and Homology Directed Repair

    Type
    Blog Post
    ...demonstrated how CRISPR nickases improve homology directed repair rates, and share their design rules for...PAM-out design.  Exploring nickases for homology directed repair The potential benefit of using nickases...could this system mediate repair throughout the entire region between the nicks? To find out, Schubert... if there are no available guides close to the desired mutation site. Quick tips for nickase design Ready...Resources on the Addgene Blog Learn about Homology Directed Repair 3 Tips to Improve HDR Efficiency How to...

  31. Q&A with Karen Katz and Carl Paratore, the Newest Members of the Addgene Board of Directors

    Type
    Blog Post
    ..., MBA, CPA to the Addgene Board of Directors. Katz is the Director of Intellectual Property Programs at...addition of Katz and Paratore onto the Board of Directors brings complementary experience and insight to...plasmids and other necessary information that’s required to do research. Paratore: What I’ve been most ...you tell me a bit about your job? Katz: I’m the Director of Intellectual Property Programs at Suffolk University...Learn more about Karen Katz, Esq Ms. Katz is the Director of Intellectual Property Programs at Suffolk University... Meet the other members of Addgene's Board of Directors Find careers at Addgene ...

  32. New and Upcoming Viral Vectors - May 2020

    Type
    Blog Post
    ...2xStrep-IRES-Puro: Expression of the SARS-CoV-2 N protein  pLVX-EF1alpha-SARS-CoV-2-M-2xStrep-IRES-Puro:...pLVX-EF1alpha-SARS-CoV-2-E-2xStrep-IRES-Puro) and NSP2 (pLVX-EF1alpha-SARS-CoV-2-nsp2-2xStrep-IRES-Puro) are also in the...M protein pLVX-EF1alpha-SARS-CoV-2-orf3a-2xStrep-IRES-Puro: Expression of the SARS-CoV-2 ORF3a Lentiviral... See our Serotype Testing AAV inventory for the entire collection! Plasmid Serotype Name Depositor ...

  33. Hot Plasmids April 2018 - Protein Degradation, Nanoscopy, FIRE-Cas9, and Yeast Expression Tools

    Type
    Blog Post
    ... Communications. 2017. PubMed PMID: 28924139. FIRE-Cas9 for inducible interrogation of the epigenome...Article contributed by Joanne Kamens Listen to the Fire-Cas9 Podcast Segment Jerry Crabtree’s lab has developed...Inducible Recruitment for Epigenome editing by Cas9 (FIRE–Cas9), combines these approaches to enable rapid...cell type. By varying which sgRNAs are used with FIRE-Cas9, experiments can be designed to target multiple...analysis of epigenetic memory at nearly any locus. The FIRE-Cas9 plasmids can be found here. Braun et al. Nat...controls expression of transcription factor 2, which directly controls expression of a reporter protein, it ...

  34. New and Upcoming Viral Vectors - June 2019

    Type
    Blog Post
    ...)-mCherry 50467  AAV2 pAAV-CaMKIIa-HA-hM4D(Gi)-IRES-mCitrine 121538  AAV5 pOTTC1484 - pAAV SYN1 HA-hM4D...Serotype Name 119741  AAV5  AAV SYN flex PSAM4 GlyR IRES EGFP Recombinase AAV Finally, we are excited ...Plasmid Serotype Name 55634  AAV1  pAAV-EF1a-mCherry-IRES-Flpo 55637  AAV1  pAAV-EF1a-Flpo Chemogenetics... Serotype Name 119472  AAV5  AV SYN PSAM4 GlyR IRES EGFP   Biosensors Plasmid Serotype Name ...in the last few months. You can also browse our entire AAV inventory. Our new AAVs include: Control AAVs...

  35. New and Upcoming Viral Vectors - Spring 2019

    Type
    Blog Post
    ...GlyR IRES EGFP Chimeric channels for neuronal manipulation 119742  AAV5  AAV SYN PSAM4 GlyR IRES EGFP...-dependent CRE) 55634  AAV1  pAAV-EF1a-mCherry-IRES-Flpo 55637  AAV1  pAAV-EF1a-Flpo Calcium sensors...released so far in 2019. You can also browse our entire AAV inventory! Our new AAVs include: pGP-AAV-syn-FLEX-jGCaMP7b-WPRE...neurotransmitter in vertebrates, but methods for directly imaging GABA have been limited. Like calcium sensors...

  36. RaPID Detection of RNA-protein Interactions

    Type
    Blog Post
    ...Element (IRE) RNA motif of the ferritin light chain RNA transcript. IRE motifs are bound by IRE binding...cannot distinguish between proteins that directly or indirectly interact with the bait. Also, RaPID can...binding proteins, IREB1 and IREB2, which post-transcriptionally regulate iron metabolism pathway transcripts...interactions or to analyze chromatin states (CHIP-seq, FAIRE-seq, Cut & Run) and to detect protein-protein interactions...RNA-protein interactions due to sample processing. Require prior knowledge that the protein of interest interacts... methods are not ideal for in vivo work. BirA* requires 16-18 hours to sufficiently biotinylate interacting...found that all HHCS-associated sequences had lower IREB2 binding enrichment compared to wild-type sequences...

  37. Viral Production at Addgene

    Type
    Blog Post
    ...cells were transduced with either pAAV-Ef1a-mCherry-IRES-Cre (55634-AAVrg) alone at 1.7E6 viral genomes (...expression alone was detected. pAAV-Ef1a-mCherry-IRES-Cre was a gift from Karl Deisseroth (Addgene viral... Cre-dependent GFP expression was detected with direct fluorescence. GFP was not detected in the absence...Control Mycoplasma Our 293T cell line was obtained directly from Takara, and is routinely tested for mycoplasma...

  38. New Viral Vectors - March 2024

    Type
    Blog Post
    ...Biosensor Looger New serotype pAAV-CAG-DIO-NLS-mRuby3-IRES-eGtACR1-ST AAV9 Optogenetics Adesnik New viral vector...

  39. Viral Vectors 101: Pseudotyping

    Type
    Blog Post
    ...doi.org/10.1128/jvi.71.8.6174-6178.1997 Wickersham IR, Finke S, Conzelmann K-K, Callaway EM (2006) Retrograde...–49 . https://doi.org/10.1038/nmeth999 Wickersham IR, Lyon DC, Barnard RJO, Mori T, Finke S, Conzelmann...Infection of these cells with VSV-G pseudotyped virus requires the upregulation of LDLR expression using other...neurons. However, VSV-G’s broad tropism can be undesired for in vivo studies since there’s the potential...neuronal cells and can travel in a retrograde direction from the synapse to the cell body, making it a...use rabies virus is to delete the glycoprotein required for entry into the cell (rabies dG). Because rabies... system (Wickersham et al., 2007). This system requires first supplying rabies glycoprotein along with...

  40. Sequencing Primers

    Type
    Guide
    ...promoter, forward primer IRES-F TGGCTCTCCTCAAGCGTATT 3' end of IRES, forward primer IRES-R CCTCACATTGCCAAAAGACG...CCTCACATTGCCAAAAGACG 5' end of IRES, reverse primer L4440 AGCGAGTCAGTGAGCGAG (Caldwell lab) 5' of MCS in L4440 vector...
Showing: 1 - 40 of 919 results