We narrowed to 48 results for: cmv promoter
-
TypeBlog Post... trying to pick your perfect promoter! Eukaryotic Promoters Promoter Primarily used for RNA .... In practice, the term "promoter" describes the combination of the promoter (RNA polymerase binding site...recognize and bind to specific promoter elements. This means that the promoter present in your plasmid backbone...RNAP II promoter, whereas small RNAs (such as shRNA) are transcribed from the RNAP III promoters. This ...post on viral vector parts. Promoter specificity Aside from choosing a promoter based on type of RNA transcript...cell types or organisms, promoters must be similarly variable. Bacterial promoters only work in prokaryotic...require unique promoters and there is very little crossover. Generally speaking, promoters in bacteria are...
-
New Acoustic Reporter Genes: Ultrasound Imaging of Gene Expression
TypeBlog Post...constitutively-expressed mARG plasmids driven by CMV promoters. Labs that are new to the mARG expression are...cotransfect a mixture of 1248 ng of CMV-gvpA-IRES-BFP plasmid and 954 ng CMV-gvpNJKFGWV plasmid into 70%-confluent...expression systems in E. coli. The arabinose-inducible promoter pBAD and a low-copy number origin of replication...integratable cassettes, both with doxycycline inducible promoters (Fig. 2a). The first cassette contains the major... -
Hot Plasmids: Spring 2025
TypeBlog Post...new backbones special: Strong expression: A CMV promoter drives robust gene expression in mammalian cells...cloned EGFP into pAG Lenti CMV N-HA Puro (Addgene #236079) to create pAG Lenti CMV HA-EGFP Puro (Addgene #236081...creation a breeze. Modular by design: Key elements (promoter, tag, polyA site) are flanked by unique restriction... both new and known regulators at the FOS gene promoter and the MYC locus (Figure 5). Figure 5:...identification of heat-shock proteins at the FOS gene promoter using TurboCas, streptavidin immunoprecipitation... -
AAV Q&A with Tim Miles
TypeBlog Post...efficient AAV prep for a 4.2 kB insert with the CMV promoter using the AAV-BR1 capsid? A: It is our understanding... ~4.7kB. If your insert alone is 4.2 kB and CMV promoter+enhancer is 0.5 kB, then you would be oversized... -
Building and Validating Recombinant Antibodies: A Case Study
TypeBlog Post...light chain, each from a constitutively active CMV promoter. Constructs were then verified by both diagnostic...green) and heavy (blue) chains as driven by two CMV promoters (orange). Figure from Andrews, et. al., Elife... -
Making CRISPR Plasmids Using Fragmid
TypeBlog Post...components, such as your CRISPR enzyme or Pol 2 promoter. The options available in each class, or module...out reporters, Cas proteins, guide cassettes, promoters, N’ and/or C’ terminus, and selection markers....lentiGuide-based) Mammalian Lentivirus pRDA_722 (CMV-driven; lentiCRISPRv2-based; preferred over 512) ...) Mammalian Lentivirus pRDA_789 (CMV-driven; CROPseq) Mammalian AAV pRDA_889 (ITRs from... -
Top Requested Plasmid of 2017 - pMD2.G
TypeBlog Post... under the control of the powerful mammalian CMV promoter. Envelope proteins are a key component of lentiviruses... -
Plasmids 101: Inducible Promoters
TypeBlog Post...will be produced. Many common promoters. like CMV, EF1A, and SV40 promoters, are always active and thus ... on repressible promoters. How are inducible promoters regulated? Inducible promoters can be regulated...commonly used prokaryotic promoters is the negative inducible pLac promoter. This promoter requires removal of...steroid regulated promoters commonly used in plant research. Promoter Subtype Promoter Example Activator...Promoters control the binding of RNA polymerase and transcription factors. Since the promoter region ...of a promoter. Below, you’ll find a short description of these three types of inducible promoters, and...Many of these promoter systems are available at Addgene! Chemically inducible promoters Chemically regulated... -
Choosing Your Perfect Empty Backbone
TypeBlog Post...pcDNA3, comes from the pcDNA series. It has the CMV promoter for mammalian expression, a multiple cloning...yeast expression vectors with various markers and promoters. If you need to visualize YGOI on a western blot...vectors carrying several fusion proteins. Pick your promoter, selection cassette and visualization vehicle ...fly genome and are under the Gal4 inducible UAS promoter. Other vectors can be expressed in fly culture...culture cells like S2 and carry the metallothionein promoter (e.g. pMT-puro). Worm vectors There are several... following the expression pattern of a defined promoter region, ectopically expressing YGOI in a pattern... -
28 Hot Plasmid Technologies from 2015
TypeBlog Post...vector containing a promoter for constitutive (CMV, SV40, SFFV) or inducible (CMV-TO) cDNA expression,...fluorescent proteins, 8 constitutive promoters, 2 includible promoters, 3 polyA terminators and various pieces...sequences. Several pre-constructed promoter-selection marker or promoter-inducible expression related vectors...plasmids: Luc (intronless; CMV-LUC2CP/ARE and Luc-I (intron-containing; CMV-LUC2CP/intron/ARE). The Luc-I...all chemically inducible promoters; 3) improving the strength of the promoters used; and 4) optimizing ...ideal promoter/location combination. However, other constructs which contain different promoters and/or...to study the human GM-CSF promoter and enhancer, a finely regulated promoter controlled by a mixture of... -
Plasmids 101: Protein Expression
TypeBlog Post...designed for mammalian expression utilize viral promoters (SV40, CMV, and RSV) for robust expression post-transfection...the use of constitutive and inducible promoters. Inducible promoters are extremely useful if a desired protein... of the galactose inducible promoter (GAL). Other commonly used promoters include the phosphate and copper... Blog Learn about inducible promoters Learn about repressible promoters Check out protein tags Resources... of these vectors is controlled by a different promoter resulting in different levels of expression from... vectors, pET, under the control of the T7 lac promoter and induced by lactose, provides the highest level...copper inducible PHO5 and CUP1 promoters respectively. Yeast cells are grown in well-defined media and... -
Synthesized by Ginkgo Bioworks, Shared by Addgene: SARS-CoV-2 Plasmids for Many Expression Systems
TypeBlog Post...expression plasmids in a high copy backbone with a T7 promoter driving multiple combinations of WT, codon optimized...which drive expression using either TEF1 or GAL1 promoters. These vectors are intended for the high level...versions of SARS-CoV-2 S (spike protein) cloned into a CMV driven expression vector are also available. These... -
Plasmids 101: In-house NGS Plasmid Quality Control Now at Addgene
TypeBlog Post...the CAG promoter, a hybrid promoter consisting of a CMV enhancer, chicken beta actin promoter, and rabbit... tags and fusion proteins Finally, we confirm promoters, tags, fusion proteins, and selectable markers... -
Introducing Addgene's New Search - Find Plasmids More Easily For Your Research!
TypeBlog Post...plasmid to express ubiquitin under control of a CMV promoter. Starting with two search terms we see there...scientists Viral prep filter categories Promoters: Select the best promoter for your target cell type Serotype...world, it can be hard to find your favorite gene, promoter, serotype, or a myriad of other things. That’s... -
Hot Plasmids June 2018 - Reverse transcriptase, nanobody, and protein-DNA interaction tools
TypeBlog Post...APEX2 is expressed from a Tet/Shield1 inducible CMV promoter and targeted to a sequence of interest with ... -
Plasmids 101: Repressible Promoters
TypeBlog Post... are repressible promoters regulated? Like inducible promoters, repressible promoters can be regulated...Promoters control the binding of RNA polymerase and transcription factors. Since the promoter region ... will be produced. Many commonly-used promoters, such as T7, CMV, EF1A, and SV40, are always active and...natural and engineered repressible promoters. Chemically repressible promoters Tet-Off In its native context... pADH1 displays low promoter activity (~20% activity of the strong yeast promoter pTEF). As ethanol accumulates...that promoter is active. In this way, you can interrogate the activity of uncharacterized promoters. Similarly... QUAS promoter, and the QF transcription factor cannot drive transcription from the UAS promoter. This... -
MXS Chaining
TypeBlog Post...(Table 1). Each construct was flanked with a CMV promoter (to drive high-level expression) and a polyA... may differ (e.g., a set of various mammalian promoters), the same cloning procedure can be used to incorporate... in this method include fluorescent proteins, promoters, enhancers, polyadenylation signals, inducible...multiple identical polyadenylation signals or promoters Gibson et al., 2009 MXS-Chaining, BioBricks,... -
CRISPR 101: Ribonucleoprotein (RNP) Delivery
TypeBlog Post... cells where common eukaryotic promoters (such as CMV or EF1A promoters found in many CRISPR plasmids)...transfection or viral transduction Appropriate promoters must be chosen for both Cas9 and gRNA expression... -
Your Lentiviral Plasmid FAQs Answered
TypeBlog Post...plasmids have a chimeric 5'LTR that includes a CMV or RSV promoter as well as a portion of the 5'LTR. Including...majority of transfer plasmids use the weak viral LTR promoter to drive expression of the gene of interest. Consequently...2nd-generation system because the wildtype 5'LTR promoter requires Tat to function. Third-generation plasmids... -
Kazuhiro Oka Lentiviral Vectors
TypeCollection...from the CMV promoter pAdx-CMV-YFP 73348 Express YFP with an NLS from the CMV promoter pAdx-CMV-dsRed 73349...gene from the CMV promoter pCDH-CMV 72265 Express gene of interest from the CMV promoter pCDH-EF1 72266...from the CMV promoter pAdx-CMV-iCre-p2A-copGFP 73350 Expresses iCre and EGFP from the CMV promoter pAdx-CMV-iCre-P2A-tdTomato...EF1 promoter while pICPIS-CB contains the Chicken-beta actin promoter with CMV enhancer. pAdx-CMV-LacZ...Xgal/IPTG plate pAdx-CMV-copGFP 73346 Expresses copGFP from the CMV promoter pAdx-CMV-tdTomato 73347 Expresses...phosphoglycerate kinase I) promoter pCDH-CMV4 72284 Express gene of interest from the CMV promoter. WPRE has been ...truncated EF1 promoter pCDH-CMV-Nluc-P2A-copGFp-T2A-Puro 73037 Expresses Nluc and copGFP from the CMV promoter... -
Multicolor Animals: Using Fluorescent Proteins to Understand Single Cell Behavior
TypeBlog Post...tandem with a single promoter, but only the gene directly following the promoter is expressed. Cre-mediated... As RFP and OFP are directly downstream of the promoter in Brainbow 1.0 and 1.1, respectively, cells will...Brainbow system are that it does not use ubiquitous promoters, meaning that not all cell types can be labeled...Brainbow was also used in zebrafish by injecting a CMV-Brainbow construct at the embryonic stage. This technique...placing Brainbow downstream of a neural-specific promoter, or the entire fish could be labeled by injecting...an RFP, CFP, and YFP downstream of a ubiquitous promoter. Zebrabow is an extremely versatile technology... -
Quick Guide to All Things Lentivirus
TypeBlog Post...and the promoter of the 5’LTR has been deleted to reduce its activity. A CMV or an EF1α promoter has been...the control of two different promoters. Both the single and dual promoter transfer vectors can be used...containing the rev response element (RRE), an internal promoter, and the desired gene (transfer vector plasmid...entry site (IRES) and expressed under the same promoter. Alternatively, your gene and the marker can be...cell cycle, a transfer vector with an inducible promoter (see below) should be used. Inducible lentiviral...Tet-response element (TRE) is placed upstream of the promoter in your transfer vector. In the absence of tetracycline... -
Luciferase Plasmid Collection
TypeCollection...of 5' promoter/enhancer regions Joshua Mendell 60323 pGL4.23-GW Firefly Insertion of 5' promoter/enhancer...fusions. Renilla luciferase under the control of a CMV promoter is present for normalization William Kaelin ...plants. Renilla luciferase under the control of a CMV promoter is present for normalization. Alejandro Ferrando...luciferase Eric Campeau 21474 pLenti CMV V5-LUC Blast (w567-1) Firefly CMV Lentiviral expression of firefly...Nano-lantern CMV Mammalian expression of Nano-lantern Takeharu Nagai 87121 pcDNA-RLuc8 Renilla CMV Mammalian... luciferase Ming-Chih Lai 100984 pGL4.18 CMV-Luc Firefly CMV Mammalian expression of firefly luciferase... Cypridina EF1α, CMV Dual secreted luciferase reporter (EF1α-Gaussia luciferase, CMV-Cypridina luciferase... -
Adenovirus Plasmids
TypeCollection...containing transgene under a chosen promoter Vogelstein 16403 pShuttle-CMV Shuttle For production of viruses...viruses containing transgene under CMV promoter Vogelstein 16404 pAdTrack Shuttle For production of GFP-trackable...containing transgene under a chosen promoter Vogelstein 16405 pAdTrack-CMV Shuttle For production of GFP-trackable...GFP-trackable viruses containing transgene under CMV promoter Vogelstein 16407 pAdEasy 2-GFP beta-gal Shuttle...transgene under mouse cofilin promoter (MCP) Bamburg 62621 pShuttle-CMV-F2A-T2A-Venus Shuttle For production...pShuttle-CMV plasmid with Gateway cassette; See article for additional plasmids Zhang 50957 RedTrackCMV Shuttle...mRFP-trackable viruses containing transgene under CMV Bamburg 50958 ShuttleNSE Shuttle For production of... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...plasmid with a promoter that will be functional in your host organism. Host Relevant Promoters Representative...genome pLenti CMV GFP DEST - Lentiviral Gateway destination vector for gene expression pLenti CMV/TO Zeo DEST...genome pAdTrack-CMV - Shuttle vector for transgene expression under a CMV ...interest to create a luciferase reporter Promoter Measure promoter strength pBV-Luc - Luciferase ...sgRNA/PTG with rice snoRNA U3 promoter and Cas9 with rice ubiquitin promoter for Agrobacterium-mediated ...pLenti CMV/TO GFP-Zeo DEST (719-1) - 3rd gen lentiviral Gateway destination vector, expression, CMV/TO promoter... promoter, GFP-Zeo pLenti CMV/TO Zeo DEST - Tet-inducible lentiviral Gateway destination... -
Simple CRISPR-based Epigenetic Editing: dCas9-directed DNA Demethylation
TypeBlog Post...hUbC-dCas9-T2A-GFP for removable dCas9 expression and pLM-CMV-R-Cre. Selection for cells stably and highly expressing...functional role of DNA demethylation at specific promoters by targeted steric blockage of DNA methyltransferase... -
Tetracycline Inducible Expression
TypeCollection... upstream of a minimal CMV promoter, and other tet- or dox-dependent promoters (sometimes generally called...17492 pLenti CMV TetR Blast (716-1) Lentiviral Tet-On vector expressing TetR from CMV promoter TetR Eric ...contains a TRE between two minimal CMV promoters. None Pbi (TRE, miniCMV) Bert Vogelstein Transactivators...may also like... Blog: Inducible Promoters Blog: Repressible Promoters Mammalian shRNA Plasmids Collection...seven copies of tet O upstream of the minimal CMV promoter. In the absence of tetracycline, tTA binds to...transactivators and promoters are generally cross-compatible. Your choice of transactivator, promoter, and type ...pLVX-Tet3G blasticidin Lentiviral Tet-On vector with CMV promoter Tet-On 3G rtTA Oskar Laur 96963 pCAG-TetON-3G... -
Lentivirus Plasmids
TypeCollection...coexpression. Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression of RFP...11795 pLL3.7 3rd Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor... were added; Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor... expression variants. Jacks 19319 pLJM1-EGFP 3rd CMV-driven EGFP fusion; can be used for cDNA expression...shRNA under the control of a tet-responsive H1 promoter Trono 11651 pLVUT-tTR-KRAB 3rd Inducible expression...with a chimeric 5’LTR, Any expression cassette (promoter and gene of interest) can be cloned into the plasmid...plasmid 17618 for GFP plasmid. Cheng 17452 pLenti CMV Puro DEST 3rd Gateway destination plasmid with constitutive... -
27 Hot Plasmids from 2016
TypeBlog Post... gRNA from a Drosophila U6:2 promoter and Cas9 from the actin 5C promoter. Addgene’s fly library web page... over 30 promoters and 140 genes, including constructs with unique tissue-specific promoters expressing...Magneto2.0 Gateway 74307 pAAV-CMV-DIO-Magneto2.0-sNRPpA AAV 74306 pAAV-CMV-DIO-TRPV4-p2A-ferritin-sNRPpA...genomic libraries are cloned downstream of a minimal promoter sequence. Should one of these random stretches...activate its own transcription from the minimal promoter and its strength can be determined from its enrichment...variety of plasmids containing many different promoters, RBS’, coding sequences (CDS), and terminators...fluorophores, generate expression vectors with various promoters suitable for in vivo expression, and/or produce... -
Control AAV Preps
TypeCollection...105531 pAAV.CMV.LacZ.bGH CMV LacZ Constitutive 5, 8 Wilson 105532 pAAV.CMV.ffLuciferase.SV40 CMV ffLuciferase...-B10 CAP-B22 MaCPNS1 MaCPNS2 AAV9-X1.1 Promoter CAG CaMKIIa CMV Dlx EF1a/nEF GFAP and variants Synapsin...Constitutive PHPeB Gradinaru 105530 pAAV.CMV.PI.EGFP.WPRE.bGH CMV EGFP Constitutive 1, 2, 5, 8, 9, rh10... 5, 8, rg*, PHP.eB Wilson 105548 pENN.AAV.CMVs.TurboRFP.WPRE.RBG CMV TurboRFP Constitutive 1, 8 Wilson...that express fluorescent proteins under general promoters. These AAV can be used to compare the activity...Constitutive (non-cre-dependent) Clear Filters ID Name Promoter Fluorophore/Tag Activity Serotype PI 37825 AAV-CAG-GFP... -
Recombinases AAV Preps
TypeCollection...Wilson 105537 pENN.AAV.CMVs.Pl.Cre.rBG CMV none 1, 2, 5, 8, 9, rh10 Wilson 105545 pAAV.CMV.HI.eGFP-Cre.WPRE.SV40...information about these molecular tools. Cre AAV ID Name Promoter Fluorophore/Tag Serotype(s) PI 105551 pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40...pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 CMV eGFP 1, 2, 5, 8, 9 Wilson 55632 pAAV-Ef1a-mCherry-IRES-Cre EF1a mCherry (not a fusion tag)....PI.Cre.rBGe TBG none 8 Wilson Dre AAV ID Name Promoter Fluorophore Serotype(s) PI 50363 AAV phSyn1(S)...DreO-bGHpA Syn none 5, rg* Zeng Flpo AAV ID Name Promoter Fluorophore Serotype(s) PI 51669 AAV phSyn1(S)...* Janelia Light-Inducible Recombinases ID Name Promoter Fluorophore Serotype(s) PI 140135 pAAV-EF1a-iCreV...pAAV-EF1a-iFlpV EF1a none 1, PHPeB Zeng VCre AAV ID Name Promoter Fluorophore/Tag Serotype(s) PI 55638 pAAV-EF1a-vCre... -
AAV Molecular Tools
TypeCollection...Activity Serotype PI 61592 pX600-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA CMV-driven, constitutive Expression of...Gradinaru 99120 pAAV-ihSyn1-tTA Inducible Synapsin promoter (ihSyn) Expression of the tet-off transactivator...pAAV-ihSyn1-DIO-tTA Cre-dependent and inducible Synapsin promoter (ihSyn) Cre-dependent expression of the tet-off... -
Neurodegeneration Plasmid Collection
TypeCollection... DCTN1 CMV ALS Trina Schroer 51221 CMV-CC2 DCTN1 CMV ALS Trina Schroer 51412 CMV-p150 DCTN1 CMV ALS Trina...Yeast Other Promoter CMV T7 polH GAL Other Clear Filters ID Plasmid Name Gene Tags Promoter Disease PI ...hATMS1981A ATM His, Flag CMV Ataxia telangiectasia Michael Kastan 32813 CMV-hEAAT1 SLC1A3 CMV Episodic ataxia ...moPrP(3F4) D177N PRNP CMV Dementia Susan Lindquist 1321 cytosolic moPrP (3F4) PRNP CMV Dementia Susan Lindquist...FLAG-hPLIC-2 UBQLN2 Flag CMV ALS Peter Howley 8662 p4456 FLAG-hPLIC-2 NTF UBQLN2 Flag CMV ALS Peter Howley 10880...DNMT1 GFP CMV Hereditary sensory neuropathy type IE Tyler Jacks 12166 pSicoR Dnmt1 DNMT1 GFP CMV Hereditary...PINK1 Myc CMV Parkinson's Mark Cookson 13315 pcDNA-DEST53 PINK1 N-GFP PINK1 GFP CMV Parkinson's Mark Cookson... -
TALEN Expression Vectors
TypeCollection...listed below have the CMV promoter for mammalian cell expression and a T7 promoter for in vitro transcription... -
Lentiviral Prep Service
TypeCollection...pLenti CMV GFP Hygro (656-4) GFP Hygromycin 3rd gen lentiviral eGFP expression vector, CMV promoter, Hygro...Cas9 protein and blasticidin resistance from EFS promoter. Lentiviral backbone. Zhang Cas9 and Accessories... -
Zhang Lab CRISPR Page
TypeCollection... sgRNA 61592 : PX600; CMV-driven SaCas9 60957 : PX551; Truncated MeCP2 promoter-driven SpCas9; for neuronal...Available plasmids are described below: 61591 : PX601; CMV-driven SaCas9; U6-driven sgRNA 61593 : PX602; TBG-driven...neuronal expression 60958 : PX552; U6 promoter-driven; for sgRNA cloning; has GFP-KASH for FACS sorting...driven by either the ubiquitous cytomegalovirus (CMV, PX601 [#61591] ) or liver-specific tyroxine binding...binding globulin (TBG, PX602 [#61593] ) promoter, and a U6-driven single guide RNA. The vector can be digested...codon-optimized SpCas9, driven by the truncated MeCP2 promoter (pAAV-pMecp2-SpCas9-spA) for expressing Cas9 in... -
Sequencing Primers
TypeGuide...Used Primers CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward primer...vectors with AOX1 promoter, forward primer 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter, forward primer...reverse primer CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward primer...Human U6 promoter, forward primer LNCX AGCTCGTTTAGTGAACCGTCAGATC (BD Biosciences) Human CMV promoter, forward...ATTTAGGTGACACTATAG SP6 promoter, forward primer T3 GCAATTAACCCTCACTAAAGG T3 promoter, forward primer T7 TAATACGACTCACTATAGGG...metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC Mouse U6 promoter, forward primer...Nopaline synthase promoter, forward primer Nmt1-F GCAATGTGCAGCGAAACTAA S. pombe nmt1 promoter, forward primer... -
University of Florida Serotype Testing Panel for the Eye and Brain
TypeCollection...information. ID Name Promoter Description Category PI 157970 pTR-UF11 chimeric CMV/Chicken Beta actin (...of retinal bipolar cells with improved mGluR6 promoters in rodents and primates. Mol Ther . 2016 Aug;23... -
Caltech Systemic Capsids
TypeCollection...CAG NLS-GFP Control Gradinaru 105530 pAAV.CMV.PI.EGFP.WPRE.bGH CMV EGFP Control Wilson 105547 pENN.AAV.... window) . Browse Available PHP.eB AAV ID Name Promoter Description Category PI Controls 28306 pAAV-FLEX-tdTomato... #103006) . Browse Available PHP.S AAV ID Name Promoter Description Category PI 28306 pAAV-FLEX-tdTomato...#127847) . Browse Available PHP.V1 AAV ID Name Promoter Description Category PI 104052 pAAV-CAG-DIO-EYFP...#185136) . Browse Available MaCPNS1 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...#185137) . Browse Available MaCPNS2 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...#175004) . Browse Available CAP-B10 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG... -
15 Years of Addgene: The Top 15 Plasmids
TypeBlog Post...customizable sgRNA from the U6 promoter and puromycin resistance from the EF-1a promoter. It’s a 3rd generation.... Find pSpCas9(BB)-2A-Puro (PX459) V2.0. pCMV-VSV-G - pCMV-VSV-G was deposited by the Bob Weinberg lab.... It can be used with packaging plasmids such as pCMV-dR8.2 dvpr (lentiviral) or pUMVC (MuLV retroviral..., this plasmid predates Addgene’s founding. Find pCMV-VSV-G. pRSV-Rev - This 3rd generation lentiviral... -
CRISPR 101: Epigenetics and Editing the Epigenome
TypeBlog Post...induce transcription at CpG regions of various promoters. Other researchers additionally fused a TAL effector...: dCas9-p300 adds H3K27ac marks to histones in promoter and enhancer regions. These marks are associated...Figure 2: dCas9-Tet1 demethylates cytosines at promoters and enhancers. This targeted demethylation is ...Figure 3: dCas9-DNMT3A methylates cytosines at promoters and enhancers. This targeted methylation is associated...-based acetyltransferase activates genes from promoters and enhancers. Nature Biotechnology 33:510–517.... Grant Challen’s lab also created constitutive (pCMV-dCas9-D3A) and Tet-dependent (TetO-dCas9-D3A) constructs... -
Protocol - pLKO.1 – TRC Cloning Vector
TypeProtocol...10878/ . Description Vector Element U6 Human U6 promoter drives RNA Polymerase III transcription for generation...transduced cells. hPGK Human phosphoglycerate kinase promoter drives expression of puromycin. Puro R Puromycin...be used with packaging plasmid pCMV-dR8.2 dvpr and envelope plasmid pCMV-VSVG from Robert Weinberg’s lab...Note: pLKO.1 could also be packaged using pCMV-dR8.2 dvpr and pCMV-VSVG from the Robert Weinberg lab. For... -
Lentiviral Vector Guide
TypeGuide...with a heterologous promoter (CMV or RSV). 5' LTR in cis Acts as an RNA pol II promoter; the transcript begins... chimeric 5’ LTR fused to a heterologous promoter (often CMV or RSV), eliminating the need for transactivation...LTR for self-inactivation LTR Viral Promoter Wildtype Hybrid promoter; 5' LTR is partially deleted and fused... fused to a heterologous enhancer/promoter such as CMV or RSV Table 1. Summary of key differences between... use a hybrid 5' LTR with a constitutive promoter such as CMV or RSV. 3' LTR in cis Terminates transcription...plasmids include tat , as the 5’ LTR is used as a promoter on the transfer plasmid, and this requires Tat...cell lines, VSV-G is often put under an inducible promoter. Depending on the cell type, there are other envelope... -
New CRISPR Web Resources and #12DaysofCRISPR Recap
TypeBlog Post...pC016 - LwCas13a guide expression backbone with U6 promoter has already earned a blue flame. RNA Editing: ...cytosine base editor pCMV-BE3 has been requested nearly 400 times, and newcomer pCMV-ABE7.10 has already... -
Gamma-Retroviral Vector Guide
TypeGuide...heterologous promoter (usually CMV or RSV). 5' LTR in cis Acts as an RNA pol II promoter; the transcript... use a hybrid 5' LTR with a constitutive promoter such as CMV or RSV. 3' LTR in cis Terminates transcription... to prefer transcription start sites, such as promoters and enhancers. Many times, integration sites are...cell lines, VSV-G is often put under an inducible promoter. Depending on the cell type, there are other envelope...selection is driven by strong enhancers and active promoters. Nucleic Acids Research , 42 (7), 4257–4269. https... -
Promoters
TypeGuide...Reference Molecular Biology Reference Promoters Promoters Definition A promoter is a region of DNA where transcription...silencers. Promoter Regions There are three main portions that make up a promoter: core promoter, proximal...Proximal Promoter Further upstream from the core promoter you will find the proximal promoter which contains...bind. Distal Promoter The final portion of the promoter region is called the distal promoter which is upstream.... Common Eukaryotic Promoters Used in Research Promoter Expression Description CMV Constitutive Strong...Specific Drosophila promoter containing Gal4 binding sites Bacterial Promoters Promoters in bacteria contain...tryptophan Promoter from E. coli tryptophan operon Ptac Regulated like the lac promoter Hybrid promoter of lac... -
15 Hot Plasmids from 2017
TypeBlog Post...Chien lab (Kwan et al., 2007) and includes four promoters, six fluorophores with nonoverlapping emission...neurodegenerative diseases, the Cole Lab selected promoters for cell types directly linked to disease, including... components can be controlled by a variety of promoters for versatile and robust engineering. These components... activity; protein purification vector 87439 pCMV-HF-BE3 HF-Cas9 (NGG) Very low off-target activity... -
Trimmer Lab NeuroMab Collection
TypeCollection...green) and heavy (blue) chains as driven by two CMV promoters (orange). Hybridoma-derived V L and V H domain...κ light chain polyA tail sequences (κ pA), a CMV promoter for heavy chain expression, and an ER signal... the p1316 plasmid that contains an upstream CMV promoter for light chain expression, and an ER signal...