Skip to main content
Addgene
Showing: 1 - 20 of 32 results

  1. An Integrin Antibody Toolkit from IPI

    Type
    Blog Post
    ...Anti-Integrin alpha L [IPI-TS2/4] Integrin alpha-L Human IgG1 Rabbit Anti-Integrin alpha L [IPI-M17/... Integrin alpha-L Mouse IgG1 Rabbit Anti-Integrin alpha L [IPI-TS1/22] Integrin alpha-L Human IgG1...Anti-Integrin alpha M [IPI-M1/70] Integrin alpha-M Mouse, Human IgG1 Rabbit Anti-Integrin alpha M [IPI-CBRM1... Integrin alpha-M Human IgG1 Rabbit Anti-Integrin alpha M [IPI-CBRM1/29] Integrin alpha-M Human IgG1...Anti-Integrin alpha M [IPI-LM2/1] Integrin alpha-M Human IgG1 Rabbit Anti-Integrin alpha 5 [IPI-MFR5...] Integrin alpha-5 Mouse IgG1 Rabbit Anti-Integrin alpha L [IPI-TS2/4] Integrin alpha-L Human IgG2a...Anti-Integrin alpha L [IPI-M17/4] Integrin alpha-L Mouse IgG2a Rat Anti-Integrin alpha M [IPI-M1/70...

  2. Immunology Research Plasmids and Resources

    Type
    Collection
    ...interferon, alpha 10 MGC119878, MGC119879 IFNA13 interferon, alpha 13 - IFNA14 interferon, alpha 14 LEIF2H...interferon, alpha 16 - IFNA17 interferon, alpha 17 IFNA, INFA, LEIF2C1 IFNA2 interferon, alpha 2 IFNA, INFA2...IFNA5 interferon, alpha 5 INFA5 IFNA6 interferon, alpha 6 - IFNA7 interferon, alpha 7 IFNA-J IFNA8 interferon...interferon, alpha 8 - IFNAR1 interferon (alpha, beta and omega) receptor 1 AVP, IFN-alpha-REC, IFNAR, IFNBR...

  4. Antibody Neutralization Response Against Pseudoviruses Expressing SARS-CoV-2 Spike Protein Variants

    Type
    Blog Post
    ...neutralize many variants, including the B.1.1.7 (Alpha variant), B1.1.298, and B.1.429 (Epsilon), nearly as well...variant) and the B.1.351 (Beta variant) were much less effectively neutralized. The B.1.617.2 (Delta variant...of luminescence.     B.1.351 variant neutralization escape The lab saw that the B.1.351 variant was very...levels of cross-neutralization occurs in the P.1 and B.1.351 variants tested. Image from Garcia-Beltran et...happening.”  In their assay, the neutralization rates of B.1.351 pseudovirus was similar to that of pseudoviruses...distinct from SARS-CoV-2 and its variants. Yet, the B.1.351 variant, which has only 9 different mutations... vaccination and after both vaccinations. For the B.1.351 variant, a single vaccination didn’t result ...

  5. Nuclear Receptor Signaling Atlas (NURSA) Plasmid Guide: Nuclear Receptors

    Type
    Collection
    ...receptor, alpha RORA Plasmids RORA, ROR1, ROR2, ROR3, RZRA, NR1F1, MGC119326, MGC119329, RZR-ALPHA, DKFZp686M2414...Plasmids ESRRA, ERR1, ERRa, ERRalpha, ESRL1, NR3B1 estrogen-related receptor alpha ESRRB Plasmids ESRRB, DFNB35... HNF4a9, HNF4alpha, MODY, MODY1, NR2A1, NR2A21, TCF, TCF14 hepatocyte nuclear factor 4, alpha NR0B1 Plasmids...5E3.5, NR1C1, PPAR, PPARalpha, hPPAR peroxisome proliferator-activated receptor alpha PPARD Plasmids PPARD... RXRA Plasmids RXRA, NR2B1 retinoid X receptor, alpha RXRG Plasmids RXRG, NR2B3, RXRC retinoid X receptor... NROB1, SRXY2 nuclear receptor subfamily 0, group B, member 1 NR1D1 Plasmids NR1D1, EAR1, hRev, THRA1,...RZR-BETA, RZRB, bA133M9.1 RAR-related orphan receptor B RORC Plasmids RORC, RP11-98D18.11-001, NR1F3, RORG...

  6. New Norepinephrine Indicators: nLightG and nLightR

    Type
    Blog Post
    ...., 2023. nLight nLight sensors are based on alpha-1a adrenergic receptor; nLightG contains circularly...generated using ColabFold (Mirdita et al., 2022). B, Representative images of HEK293T cells and neurons...Wasielewski, L. M., Sönmez, L., Benke, D., Weber, B., Bohacek, J., Reiner, A., … Patriarchi, T. (2023)...blocked by alpha2-AR antagonist, nLight sensors are not. Instead, they are blocked by alpha1-AR antagonist...antagonist. This is important because alpha2-AR can provide inhibitory feedback in response to norepinephrine...multiplexing in experiments, including ones that study alpha2-AR. Selectivity Norepinephrine and dopamine are...

  8. Cre-lox system

    Type
    Collection
    ...fusion EF-1 alpha Mammalian Sauer 11955 pBS505 EF1alpha-EGFPcre* Cre-EGFP fusion EF-1 alpha Mammalian Sauer...mCherry coexpression EF-1 alpha AAV Deisseroth 55635 pAAV-EF1a-sCre SCre EF-1 alpha AAV Deisseroth 55636 pAAV-EF1a-Cre...pAAV-EF1a-Cre Cre EF-1 alpha AAV Deisseroth 55638 pAAV-EF1a-vCre VCre EF-1 alpha AAV Deisseroth 59701 pRetroQ-Cre-ERT2...11920 pBS500 EF1alpha-GFPcre Cre-GFP fusion EF-1 alpha Mammalian Sauer 11923 pBS598 EF1alpha-EGFPcre Cre-EGFP...Cre hCMV Mammalian Sauer 11918 pBS513 EF1alpha-cre Cre EF-1 alpha Mammalian Sauer 11919 pBS448 RSV-GFPcre...pDIRE iCre and FlpO, required for dual RMCE EF-1 alpha Mammalian Zeller 26850 pBF3038 Cre codon optimized... Cre-IRES-PuroR Cre and PuroR coexpression EF-1 alpha Lentiviral Kotton 30524 pCSHSP:Cre heat shock inducible...

  9. Allen Institute for Cell Science Plasmid Collection

    Type
    Collection
    ...Matrix Adhesions 87421 TUBA1B-mEGFP AICSDP-4 mEGFP Alpha-tubulin Microtubules 87422 LMNB1-mEGFP AICSDP-10...Peroxisomes 101785 TUBA1B-mTagRFP-T AICSDP-28 mTagRFP-T Alpha-tubulin Microtubules 101786 ST6GAL1-mEGFP AICSDP...Transcription Factor 124607 ACTN2-mEGFP AICSDP-63 mEGFP Alpha-actinin-2 Sarcomeric z-disks 124608 NPM1-mTagRFP-T...MAP1LC3B-mEGFP AICSDP-25 mEGFP Autophagy-related protein LC3 B Autophagosomes 101784 SLC25A17-mEGFP AICSDP-27 mEGFP...cells (Link opens in a new window) References Roberts B, Haupt A, Tucker A, Grancharova T, Arakaki J, Fuqua...

  10. Split Fluorescent Proteins for Studying Protein-Protein Interactions

    Type
    Blog Post
    ... high-throughput screen for molecules affecting alpha-synuclein oligomerisation. Eastwood T, Baker K, ...FP(11) and FP(1-10) fragments. When Protein A and B interact, the FP fragments can assemble the full structure...signal amplification. Zhou S, Feng S, Brown D, Huang B. PLoS One. 2020 Bo Huang Yellow Venus pBiFC-VN173...

  11. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...Microtubules alpha-tubulin mCherry* Michael Davidson 12298 pIRESneo-EGFP-alpha Tubulin Microtubules alpha-tubulin...Microtubules alpha-tubulin mTurquoise2 Dorus Gadella 85045 pmScarlet_alphaTubulin_C1 Microtubules alpha-tubulin...EGFP Anthony Brown 11908 pEGFP-N1 alpha-actinin 1 Actin Filaments alpha-actinin 1 EGFP Carol Otey 27676 ...mGold Francois St-Pierre 49149 mCh-alpha-tubulin Microtubules alpha-tubulin mCherry Gia Voeltz 89472 GFP-hChibby1...Beta-catenin EGFP Alpha Yap 67937 mouse E-cadherin GFP (423) Adherens Junctions E-cadherin EGFP Alpha Yap 71366...Anna Huttenlocher 11908 pEGFP-N1 alpha-actinin 1 Focal Adhesions alpha-actinin 1 EGFP Carol Otey 31923 ...pPAmCherry-a-tubulin Microtubules alpha-tubulin PAmCherry Vladislav Verkhusha 31949 pPAmCherry-b-actin Actin Filaments...

  12. Validated gRNA Sequences

    Type
    Collection
    ...Moffat AMPK alpha 1 H. sapiens GGCTGTCGCCATCTTTCTCC 74374 nick S. pyogenes 26816379 Shaw AMPK alpha 1 H. sapiens...Shaw AMPK alpha 2 H. sapiens GTCAGCCATCTTCGGCGCGCG 74376 nick S. pyogenes 26816379 Shaw AMPK alpha 2 H. sapiens...BT1754 B. thetaiotaomicron GAAAATGGGGTGTATCCTGC 68892 interfere S. pyogenes 26918244 Lu BT1854 B. thetaiotaomicron...Zhang lC.GA4a B. oleracea GTTGAGAGGGGAGCCGGTGA 68256 cut S. pyogenes 26616834 Patron lC.GA4a B. oleracea ...48651 cut N. meningitidis 24076762 Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48652 cut N. meningitidis...48653 cut S. thermophilus 24076762 Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48654 cut S. thermophilus...48655 cut T. denticola 24076762 Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48656 cut T. denticola...

  13. Ras Pathway

    Type
    Collection
    ... PPP1CA Protein phosphatase 1 catalytic subunit alpha PREX2 Phosphatidylinositol-3,4,5-trisphosphate-dependent... kinase AMP-activated: A1,A2: Catalytic subunit alpha B1,B2: non-catalytic subunit beta G1, G2, G3: non-catalytic...factor of kappa light polypeptide gene enhancer in B-cells 1 PAK PAK1 PAK2 PAK3 PAK4 p21 protein (Cdc42...RAF1 Serine/threonine kinases: A-Raf proto-oncogene B-Raf proto-oncogene Raf-1 proto-oncogene RAL RALA RALB...

  14. p53 Pathway

    Type
    Collection
    ...GADD45G Growth arrest and DNA-damage-inducible; alpha, beta, or gamma IGF-BP3 Insulin-like growth factor...Caspase 9, apoptosis-related cysteine peptidase Cyclin B CCNB1 CCNB2 CCNB3 Cyclin B1, 2, or 3 Cyclin D CCND1... protein 3 KAI CD82 molecule Maspin Serpin family B member 5 MDM2 MDM2 proto-oncogene, E3 ubiquitin protein... p53R2 p53 inducible, ribonucleotide reductase M2 B (RRM2B) PAG608 Zinc finger, matrin-type 3 PAI Serpin... Ghebranious N, Igelmann H, Lu X, Soron G, Cooper B, Brayton C, Park SH, Thompson T, Karsenty G, Bradley...human cancers. Hollstein M, Sidransky D, Vogelstein B, Harris CC. Science. 1991 Jul 5;253(5015):49-53. PubMed...

  15. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ...plasmids B. Designing shRNA Oligos for pLKO.1 B.1 Determine the optimal 21-mer targets in your gene B.2 Order...search for “pLKO”“. Back to Top B. Designing shRNA Oligos for pLKO.1 B.1 Determining the Optimal 21-mer...NEB #M0202S T4 DNA ligase buffer NEB #B0202S DH5 alpha competent cells Invitrogen #18258-012 Qiaquick gel...Transform 2 μL of ligation mix into 25 μL competent DH5 alpha cells, following manufacturer’s protocol. Plate ...will alleviate concerns about off-target effects. B.2 Ordering Oligos Compatible with pLKO.1 To generate...insert your sense and antisense sequences from step B.1 into the oligos below. Do not change the ends; these...digestion with EcoRI and AgeI. The oligos from section B contain the shRNA sequence flanked by sequences that...

  16. Hot Plasmids: Summer 2024

    Type
    Blog Post
    ... workflow. B) Detail of spacer peptides (3HB: 11-nm 3-helix bundle; SAH: 60-nm single alpha helix) and...denaturated (left) or complexes may dissociate  (right). B) Protein samples protected from AWI by helical LEAs... McElroy, A., Tao, Y. A., Duby, J. E., Steinbeck, B. J., McCreary, J., Pierce, S. E., … & Liu, D. R. (...

  17. New Tools Enable CRISPRa for Neuroscience Applications

    Type
    Blog Post
    ...promoters, including calmodulin-dependent kinase II alpha (aCaMKII; excitatory neurons) and Synapsin-1 (pan-neuronal...Cre-dependent SPH construct for generating the SPH mouse. (B) AAV plasmids used to express CRE under neuron-specific...

  18. TALENs for Endogenous Zebrafish Genes

    Type
    Collection
    ...TGCTTTCACGCATTGCACtacacattggcaagatgGCAGCCACCATCGGGAGA prothymosin alpha a TAL3344 & TAL3345 TTATCATTCGCATCTCGTatttctctttatattaTTTTATTCCGAGACCCCA...TCTTTTTGTGCTGCGCCAcccagcccataatcgaGTCTTCTACAGGCATGAA retinitis pigmentosa GTPase regulator b TAL3528 & TAL3529 TGGAGAAACAGAAGATGAaatccccgagtccggaGCTGTCTTCACTTTTGGA...TGGAGAAACAGAAGATGAaatccccgagtccggaGCTGTCTTCACTTTTGGA retinitis pigmentosa GTPase regulator b ORF15 TAL3530 & TAL3531 TAAGAGGGCGGAGCTTTTatctcgcaaagctctgCCCACTGAGTTACTTAGA...TTTATGAGTCTTGTTTTCtcctcttgctcaacttGATTCTCCATATCTCCTA Scoc-b TAL3162 & TAL3163 TATGAGTCTGGTCTTCTCctccaactccacttgaTTTTCTATGTCACCTGGA...

  19. Neurodegeneration Plasmid Collection

    Type
    Collection
    ..., V5 EF-1 alpha Parkinson's Mark Cookson 25081 pDEST51-LRRK2-R1441C LRRK2 His, V5 EF-1 alpha Parkinson's..., V5 EF-1 alpha Parkinson's Mark Cookson 25083 pDEST51-LRRK2-R1441H LRRK2 His, V5 EF-1 alpha Parkinson's..., V5 EF-1 alpha Parkinson's Mark Cookson 29398 pDEST51-LRRK2-R1398Q LRRK2 His, V5 EF-1 alpha Parkinson's..., V5 EF-1 alpha Parkinson's Mark Cookson 29400 pDEST51-LRRK2-T1343G LRRK2 His, V5 EF-1 alpha Parkinson's...30147 pCAX APPs-695-alpha APP CAG Alzheimer's Dennis Selkoe 30149 pCAX APPs-751-alpha APP CAG Alzheimer'...51437 human Alpha-synuclein SNCA T7 Parkinson's Michael J Fox Foundation MJFF 51486 pET21a-alpha-synuclein...-SOD1WT SOD1 EF-1 alpha ALS Mohan Babu 83445 pLEX_307-SOD1E133delta SOD1 EF-1 alpha ALS Mohan Babu 83446...

  20. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...-Ankyrin-B [N105/13R] Ankyrin-B Human Mouse IgG2a 177494 Anti-Ankyrin-B [N105/17R] Ankyrin-B Human Mouse...Mouse 190523 Ankyrin-B scFv [N105/13] N105/13 scFv Ankyrin-B Human Mouse 190524 Ankyrin-B scFv [N105/17] N105...IgG2a 190302 Anti-Gs protein, alpha subunit [N192/12] Gs protein, alpha subunit Cow Mouse IgG2a 190303...Mouse Mouse IgG2a 206555 Anti-Alpha-2C adrenergic receptor [N330A/80R] Alpha-2C adrenergic receptor Human... Mouse 219492 Anti-Alpha-2C adrenergic receptor scFv [N330A/80 scFv] N330A/80 Alpha-2C Human Mouse 219493...cytoplasmic) Mouse Mouse IgG2a 114544 Anti-GABA(B)R2 [N153/5.1R] GABA(B)R2 Human Mouse IgG2a 114545 Anti-Uncx [...channel Rat Mouse IgG2a 188163 Anti-VAPA/B [N479/107R] VAPA/B Mouse IgG2a 188164 Anti-GFP [N86/44R] GFP...
Showing: 1 - 20 of 32 results