We narrowed to 20 results for: PGK
-
TypeBlog Post..., Cre-containing adenovirus (Ad-Cre) or AAV (AAV-pgk-Cre) has been used to successfully introduce Cre ...
-
Plasmids 101: Knockout/Knock-In Plasmids
TypeBlog Post...with GFP, as seen in blue flame plasmid OCT4-eGFP-PGK-Puro from the Jaenisch lab. Figure 3: A... -
Adenoviral Delivery of CRISPR/Cas9 Aims to Expand Genome Editing to Primary Cells
TypeBlog Post...the plasmids at Addgene: pAdSh.PGK.Cas9 (expresses S. pyogenes Cas9 from the PGK promoter) and U6 promoter-driven...plasmids which have been deposited to Addgene are: pAdSh.PGK.Cas9, pAdSh.U6.gRNAS1, and pAdSh.U6.gRNAGFP. Gonçalves... -
Kazuhiro Oka Lentiviral Vectors
TypeCollection...interest from the CB promoter pCDH-PGK 72268 xpress gene of interest from the PGK (phosphoglycerate kinase I)...enhancer pCDH-PGK-Nluc-P2A-copGFP-T2A-Puro 73040 Expresses Nluc and copGFP from the PGK promoter Adenoviral... -
Luciferase Plasmid Collection
TypeCollection...transfection Feng Zhang 21471 pLenti PGK V5-LUC Neo (w623-2) Firefly PGK Lentiviral expression of firefly ...luciferase Linzhao Cheng 74444 pLenti.PGK.blast-Renilla_Luciferase Renilla PGK Lentiviral expression of Renilla...Myc tag Erich Wanker 124701 pLenti-PGK-Venus-Akaluc (neo) Akaluc hPGK Lentiviral expression of Venus-Aka-luciferase...luciferase Mark Kay 140328 pLenti-PGK-Venus-Fluc (puro) Firefly hPGK Lentiviral expression of Venus-firefly...firefly luciferase Eric Kowarz 18782 MSCV Luciferase PGK-hygro Firefly SV40 Retroviral expression of firefly... -
Recombinases AAV Preps
TypeCollection...AAV.rTH.PI.Cre.SV40 rTH none 9, rg* Wilson 24593 AAV-pgk-Cre PGK none rg* Aebischer 51507 AAV pmSyn1-EBFP-Cre ... -
Lentivirus Plasmids
TypeCollection...pULTRA. Moore 19319 pLJM1-EGFP 3rd for EGFP fusion; PGK driven puromycin Sabatini 25895 pLX301 3rd Gateway...3rd Inducible lentiviral expression, TRE-gateway; PGK-rtTA-2A-puro. See article for more versions of this... -
Retrograde AAV viral preps
TypeCollection....WPRE.rBG EF1a EGFP Control Wilson 24593 AAV-pgk-Cre PGK Cre expression Recombinases Aebischer 55632 pAAV-Ef1a-mCherry-IRES-Cre... -
Retrovirus Plasmids
TypeCollection...increases export to the cytoplasm Hahn 11375 MDH1-PGK-GFP_2.0 MSCV Retroviral construct for miRNA expression... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...Plasmids and Resources collection page Yeast GAL4, PGK, ADH1, ADE2, TRP1 Gateway destination ...EGFP - 3rd gen lentiviral vector for EGFP fusion; PGK driven puromycin Hygromycin Mammalian, Varies pLKO...mCherry selectable marker pMSCV-U6sgRNA(BbsI)-PGKpuro2ABFP - For retroviral delivery of one sgRNA pMKO.1... -
Allen Institute for Cell Science Plasmid Collection
TypeCollection...mTagRFPT Lamin B1 Nuclear envelope 114404 AAVS1-mEGFP (PGK) AICSDP-36 mEGFP NA Cytoplasm 114405 ATP2A2-mEGFP... -
Fluorescent Protein Guide: Subcellular Localization
TypeCollection...H2B GFP Geoff Wahl 21210 PGK-H2BeGFP Chromatin H2B EGFP Mark Mercola 21217 PGK-H2BmCherry Chromatin H2B... -
Promoters
TypeGuide...CAG Constitutive Strong hybrid mammalian promoter PGK Constitutive Mammalian promoter from phospholycerate... -
Sequencing Primers
TypeGuide...virus LTR (MoMuLV), forward primer mPGK-F CATTCTGCACGCTTCAAAAG Mouse PGK promoter, forward primer MSCV CCCTTGAACCTCCTCGTTCGACC... -
Neurodegeneration Plasmid Collection
TypeCollection...10880 pCCL cPPT PGK EGFP WPRE LTR H1 shSOD1 SOD1 H1 ALS Patrick Aebischer 10881 pCCL cPPT PGK EGFP WPRE LTR...Parkinson's Niels Gehring 66818 pCCL-PGK-SPdCas9-BFP-DNMT1 DNMT1 PGK Hereditary sensory neuropathy type ...Lippincott-Schwartz 164214 PLEX-PGK-ANXA11-mCerulean ANXA11 mCerulean PGK ALS Jennifer Lippincott-Schwartz... Parkinson's, FTD Mark Mayford 35000 Nurr1 NR4A2 PGK Parkinson's Malin Parmar 35217 psen2_L (OZ577) PSEN2...Trimmer 129409 Slc1a3-CreERT2 Targeting Vector SLC1A3 PGK Episodic ataxia Walker Jackson 129410 px335 Slc1a3... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...59936 Worm BsaI none S. pyogenes Fire pGL3-U6-sgRNA-PGK-Puro 51133 Mammalian none S. pyogenes Puro Huang ...cut S. pyogenes Puro Zhang pKLV-U6gRNA(BbsI)-PGKpuro2ABFP 50946 Mammalian/Lentiviral BbsI none S. pyogenes... S. pyogenes Puro Maehr pKLV-U6gRNA-EF(BbsI)-PGKpuro2ABFP 62348 Mammalian/Lentiviral BbsI none S. pyogenes... -
Plasmids 101: The Promoter Region – Let's Go!
TypeBlog Post...virus 40 Constitutive May include an enhancer. PGK1 (human or mouse) General expression mRNA Mammalian... -
28 Hot Plasmid Technologies from 2015
TypeBlog Post...the genome. In this work, they use AAVS1_Puro_PGK1_3xFLAG_Twin_Strep and nuclease driven recombination ... -
Protocol - pLKO.1 – TRC Cloning Vector
TypeProtocol... preintegration complex in the transduced cells. hPGK Human phosphoglycerate kinase promoter drives expression... -
Botman-Teusink Yeast FP Collection
TypeCollection...plasmid (Vickers et al., 2013) containing the TEF1 or PGK1 promoters and the KanMX marker. ID Plasmid Gene/...