Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 45 results for: RCA

Clear keywords
Showing: 1 - 20 of 45 results

  1. Adenoviral Vector Production and Troubleshooting

    Type
    Blog Post
    ...Importantly, recombination-competent adenovirus (RCA) can be generated if the E1 gene from the packaging...therefore recommended to test for the presence of RCA in the viral stock by doing a plaque formation assay...are commercially available for faster detection of RCA. 2nd Gen AdVs were designed to have increased cloning...capacity, decreased  potential for the generation of RCA and reduced immunogenicity. In addition to E1/E3,...

  2. Adenovirus Guide

    Type
    Guide
    ...production of replication-competent adenoviruses (RCAs) that would be able to infect cells and replicate...production, and higher titers. However, the risk of RCA formation is higher for first-generation rAdV vectors...exposed. There is a risk of spontaneous reversion to RCAs, although this has been reduced by providing the...adenovirus and replication-competent adenovirus (RCA) contaminants . Experimental & Molecular Medicine...material into cells. Replication-competent adenovirus (RCA) Mutated adenoviral vector that has the ability to...

  3. Sequencing Primers

    Type
    Guide
    ...TCCTTTCCAGCGAGGTTCTA Murine leukemia virus (MuLV) Reverse RCAS-F ACATGGGTGGTGGTATAGCGCTTGCG 3' of Rous sarcoma ...

  4. Hot Plasmids: Fall 2025

    Type
    Blog Post
    ...fluorescent and optogenetic tools. FRCaMPi uses an inverted topology of FRCaMP (itself based on mApple, which...Although similar in brightness to jRGECO1a and FRCaMP, FRCaMPi had better dynamic range and sensitivity, in...regions of live zebrafish larvae expressing FRCaMPi or SomaFRCaMPi in neurons; scale bars 50 µm. Reproduced...transfer tracker Red calcium indicators PinkyCaMP and FRCaMPi Micropeptide killswitch for biomolecular condensates....0510511103      Red calcium indicators PinkyCaMP and FRCaMPi By Mike Lacy Many popular genetically encoded calcium...Olivia Masseck Lab (Fink & Imai et al., 2024) and FRCaMPi from the Kiryl Piatkevich Lab (Zhou, Zhu, Eom, ...PinkyCaMP is the first based on mScarlet. Compared to RCaMP3 and jRGECO1a, PinkyCaMP had better brightness, ...

  5. Biosensor AAV Preps

    Type
    Collection
    ...Gong Calcium Sensor: jRCaMP1 100846 pAAV.CAG.Flex.NES-jRCaMP1a.WPRE.SV40 CAG jRCaMP1a none Cre dependent...Douglas Kim , GENIE Project 100848 pAAV.Syn.NES.jRCaMP1a.WPRE.SV40 Syn jRCaMP1a none Constitutive 1, 9 Douglas...GENIE Project 100849 pAAV.CAG.Flex.NES-jRCaMP1b.WPRE.SV40 CAG jRCaMP1b none Cre dependent 1 Douglas Kim , ...GENIE Project 100850 pAAV.Syn.Flex.NES-jRCaMP1b.WPRE.SV40 Syn jRCaMP1b none Cre dependent 1 Douglas Kim , ... GENIE Project 100851 pAAV.Syn.NES-jRCaMP1b.WPRE.SV40 Syn jRCaMP1b none Constitutive 1, 9 Douglas Kim ...jYCaMP1 axon-jYCaMP1 Red Calcium Sensors CaMPARI jRCaMP1 jRGECO1 sRGECO Far-Red/NIR Calcium Sensors HaloCaMP1a...

  6. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...AV-1-PV3850 100849-AAV1 pAAV.CAG.Flex.NES-jRCaMP1b.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV3851 ...PV3851 100850-AAV1 pAAV.Syn.Flex.NES-jRCaMP1b.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV3852 100851-AAV1...AAV1 pAAV.Syn.NES-jRCaMP1b.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV3853 100846-AAV1 pAAV.CAG.Flex.NES-jRCaMP1a.WPRE.SV40...pAAV.CAG.Flex.NES-jRCaMP1a.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV3855 100848-AAV1 pAAV.Syn.NES.jRCaMP1a.WPRE.SV40... Kim AV-9-PV3852 100851-AAV9 pAAV.Syn.NES-jRCaMP1b.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-9-PV3855 ...PV3855 100848-AAV9 pAAV.Syn.NES.jRCaMP1a.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-9-PV4365 107790-AAV9 AAV.CamKII.GCaMP6s.WPRE.SV40...AV-1-PV3854 100847-AAV1 pAAV.Syn.Flex.NES-jRCaMP1a.WPRE.SV40 GENIE, Douglas Kim AV-10-18917P 18917-AAV1...

  7. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...Calcium Red calcium sensor FRCaMPi and SomaFRCaMPi, inverted topology of FRCaMP (Fungus based Red CalModulin...Calcium Red Calcium indicators based on mRuby (jRCaMP1a, jRCaMP1b) and mApple (jRGECO1a) (Constitutive or Cre-dependent... Calcium Fast red fluorescent calcium sensors (fRCaMP1/2, fRGECO1/2) The kinetic mechanisms of fast-decay....0 Project Calcium Mitochondrial and cytosolic RCaMP1h calcium sensors, ER-targeted CEPIA1er ER-mitochondria...Masseck Calcium Astrocyte AAV-mediated expression of jRCaMP1a, a red fluorescent calcium sensor Using Genetically...name, target, publication title or keywords (e.g. "RCaMP", "caspase", "mTORC1", "mitochondria"). ID Plasmid...

  11. 3 Challenges in Plant Synthetic Biology

    Type
    Blog Post
    ...components: the pigments (anthocyanins), and the plant circadian clock. Petunias have been a model organism for...characterized mechanisms and components of the circadian rhythm in petunias. Because of the extensive research...

  13. Antibody Validation for Flow Cytometry

    Type
    Blog Post
    ..., D., McDowell, I., Southern, K., Reintsch, W., Durcan, T. M., Brown, C., Bandrowski, A., Virk, H., Edwards...., Benaliouad, F., Gileadi, O., McBride, H. M., Durcan, T. M., Edwards, A. M., Healy, L. M., Robertson...

  14. Technical Design of a Western Blot

    Type
    Blog Post
    ...are not with denaturing agents like DTT or β-mercaptoethanol.  Denaturing proteins To denature your proteins...you'll want to use SDS and either DTT or β-mercaptoethanol (BME). DTT is a stronger reducing agent than...

  15. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...15R] BAF53b Human Mouse IgG2a 177534 Anti-NrCAM [N343/26R] NrCAM Mouse Mouse IgG2a 177535 Anti-Kir6.2 K+...mouse) IgG2b 231817 NrCAM (Mus musculus) recombinant mouse monoclonal antibody NrCAM Mouse M. musculus ...

  16. Western Blot

    Type
    Protocol
    ...Microcentrifuge tubes BCA Assay, Thermo Fisher 23227 β-mercaptoethanol 4X protein loading buffer Precast SDS-PAGE ...sample for loading as follows: Add 10% v/v β-mercaptoethanol to the 4X protein loading buffer. Dilute 4X...
Showing: 1 - 20 of 45 results