We narrowed to 37 results for: polya

... both polyadenylation and termination. Out of those listed, the SV40 late polyA and rbGlob polyA are thought... polya...purpose and mechanism of polyadenylation vary across cell types, but polyadenylation generally serves to promote... and polyadenylation enzymes, in a process that seems to couple termination with polyadenlyation. Mammalian...working with plasmids! What are termination and polyadenylation? The role of the terminator, a sequence-based...after any 3’ regulatory elements, such as the polyadenylation or poly(A) signal. While many studies focus...half-life, and ultimately gene-expression. Polyadenylation is the post-transcriptional additional of multiple...

...just upstream of the final ITR.  polyA  The polyadenylation or polyA signal aids in the nuclear export...translation, and promotes RNA transcript longevity. The polyA is located at the end of the AAV genome, just upstream...

...CREATE cap plasmid, loxP sites flank the downstream polyA sequence. When viruses produced from this plasmid...into an animal with cell-type-specific Cre, the polyA sequence is inverted only in the Cre-expressing ...

...vectors (LTRs and ITRs), plasmids with multiple polyA sites, and other plasmids that contain repeating...

...Adeno X shuttle vector with EF1 promoter and SV40 polyA pICPIS-CB 73356 AdenoX shuttle vector with chicken-beta...chicken-beta actin CMV enhancer promoter SV40 polyA Addgene Resources For more information on lentiviral ...

... before considering the need for some manner of polyA. In this scenario, you may be best served by a dual...

...contains a promoter, the gene of interest, and a polyA signal. Created with biorender.com. ITR structure...

...promoter (to drive high-level expression) and a polyA signal (to terminate transcription) and the four...fluorescent proteins, promoters, enhancers, polyadenylation signals, inducible gene-expression sequences...polycistronic containing multiple identical polyadenylation signals or promoters Gibson et al., 2009 ...

...which contains a promoter, the envelope gene, and a polyA tail.   Figure 1: Lentiviral production uses...

...Modular by design: Key elements (promoter, tag, polyA site) are flanked by unique restriction sites so...

...guide to working with Drosophila Terminators and PolyA Signals FLEx Vectors Resources at Addgene.org ...

...luciferase James Wilson 101156 T7-CMVtrans-FFLuc-polyA Firefly T7 Expression of firefly luciferase from...Michael Rosbash 128046 pGL3basic luciferase and renilla_polyA Firefly, Renilla Dual reporter vector. Insertion...

...Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region Reverse CAT-R GCAACTGACTGAAATGCCTC 5' end...DsRed1 Reverse EBV Reverse GTGGTTTGTCCAAACTCATC SV40 polyA terminator Reverse Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC...promoter Forward SV40pA-R GAAATTTGTGATGCTATTGC SV40 polyA Reverse SV40pro-F TATTTATGCAGAGGCCGAGG SV40 promoter...Reverse TK-pA-R TTGTCTCCTTCCGTGTTTCA Thymidine kinase polyA Reverse Tn7-end GGGGTGGAAATGGAGTTTTT Bacteria transposon...

...constitutive promoters, 2 includible promoters, 3 polyA terminators and various pieces for inducible expression... a duplicated SV40 polyadenylation region instead of the synthetic polyadenylation signal present in pGL3...

...Repressible Promoters Plasmids 101: Terminators and PolyA signals More Plasmids 101 topics Content last reviewed...

... protein mix by size Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) is the first...transfer of proteins from sodium dodecyl sulfate-polyacrylamide gels to unmodified nitrocellulose and radiographic...) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and...

...and Bester 2021). For example, inserting a polyadenylation signal downstream of the transcription start...fragment. (D) Knock-in: insertion of a synthetic polyadenylation (spA) signal. Figure and caption adapted from...

...gene start) and a transcription termination/polyadenylation signal sequence (gene end). A minigenome is..., where it will terminate transcription and polyadenylate the mRNA. These mRNAs are translated by cellular...

...transcription started by 5' LTR by the addition of a polyA tract just after the R sequence. WPRE in cis Woodchuck...

...ladder works well for both agarose and native polyacrylamide gels. Get Tips on Verifying Your Plasmid ...