We narrowed to 5 results for: polya

...Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region Reverse CAT-R GCAACTGACTGAAATGCCTC 5' end...DsRed1 Reverse EBV Reverse GTGGTTTGTCCAAACTCATC SV40 polyA terminator Reverse Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC...promoter Forward SV40pA-R GAAATTTGTGATGCTATTGC SV40 polyA Reverse SV40pro-F TATTTATGCAGAGGCCGAGG SV40 promoter...Reverse TK-pA-R TTGTCTCCTTCCGTGTTTCA Thymidine kinase polyA Reverse Tn7-end GGGGTGGAAATGGAGTTTTT Bacteria transposon...

...Repressible Promoters Plasmids 101: Terminators and PolyA signals More Plasmids 101 topics Content last reviewed...

...transcription started by 5' LTR by the addition of a polyA tract just after the R sequence. WPRE in cis Woodchuck...

...transcription started by 5' LTR by the addition of a polyA tract just after the R sequence. WPRE in cis Woodchuck...

... nuclear export. Poly(A) signal in cis The polyadenylation or poly(A) signal aids in the nuclear export...