We narrowed to 232 results for: SPL;
-
TypeProtocol...correctly assembled plasmids by designing primers to split an antibiotic resistance gene to effectively create...
-
Lentivirus Production
TypeProtocol...obtaining high viral titer. 293T cells should be split 3 times a week: Monday: Plate 1×10 6 cells in a ... -
Antibody Validation Using the Indirect ELISA Method
TypeProtocol...greenish solution. Stop the reaction before any wells display a green product. A precipitated product indicates... -
CRISPR Library Amplification
TypeProtocol... is better than pulling motion Take care not to split or gouge agar during the scraping process. Add each... -
27 Hot Plasmids from 2016
TypeBlog Post.... Each gene was chosen to represent the primary splice variant in 38 types of human cancer. Many of the... -
Adeno-associated virus (AAV) Guide
TypeGuide...AAV8, AAV9 Table 1: Summary of tissue tropism displayed by different AAV serotypes. Pseudotypes Pseudotyping...derived from eight different serotypes. AAV-DJ displays a higher transduction efficiency in vitro than...specific cell and tissue types, like AAV-DJ8, which displays enhanced brain uptake. Systemic capsids Another...employed to engineer an rAAV serotype variant able to display neuronal retrograde transport, AAVrg. Retrograde...limitation for CRISPR delivery for more information. Split AAVs to increase packaging capacity Another strategy...derived plasmids and base/prime editors, is to create split AAVs. Here, a longer transgene is broken down between...different mechanisms. One of these methods uses splice site donor and acceptor sequences to reconstitute... -
Sequencing Primers
TypeGuide...promoter/origin, forward primer SV40-spliceR CACAAAGATCCGGACCAAAG SV40 splice sequence, reverse primer T3 GCAATTAACCCTCACTAAAGG...vector, forward primer SFFV-F ATTGATTGACTGCCCACCTC Spleen focus forming virus 5' LTR, forward primer SP6 ... -
Lentiviral Vector Guide
TypeGuide... Rev Response Element (RRE) within unspliced and partially spliced transcripts to facilitate nuclear export... a few key ways. First, the packaging system is split into two plasmids. Although safer, this system can... -
CRISPR Guide
TypeGuide... reverse transcription. The edited DNA strand displaces the unedited 5’ flap, and the resulting heteroduplex...including editors based on a second ADAR variant that displays improved specificity, and editors carrying an ... in vivo RNA imaging or to control alternative splicing. Figure 13: Overview of RNA targeting (A) and ...locus-specific targeting of long RNAs with CRISPR-Display. Nature Methods , 12 (7), 664–670. PMID: 26030444... -
Plan Your Experiment
TypeGuide...should be made HDR requires a repair template and displays reduced efficiency compared to NHEJ knockout. ...region is removed from the mRNA due to alternative splicing. Exons near the N-terminus are targeted since ... -
Optogenetics Guide
TypeGuide...photocurrent amplitude 490 ChR/T159C T159C mutation; displays increased photocurrents 470 SFO/SSFO Step function... -
Adenovirus Guide
TypeGuide...26–45 kb in length and contain multiple heavily-spliced transcripts flanked by two inverted terminal repeats...