We narrowed to 237 results for: SPL;

...critical role the work would not have been possible. Display of work in artistic exhibitions or showcases (not...

...correctly assembled plasmids by designing primers to split an antibiotic resistance gene to effectively create...

... to tumor formation in iPSC-derived and iPSC-transplanted mice. Cre-deletable or Tet-inducible lentiviruses...

...obtaining high levels of virus. HEK293T cells should be split 3 times a week: Monday: Plate 1x10 6 cells in a ...

...cassette. The simpler system of pCRISPomyces-2 displays a higher editing efficiency, perhaps due to its...

...obtaining high viral titer. 293T cells should be split 3 times a week: Monday: Plate 1×10 6 cells in a ...

...greenish solution. Stop the reaction before any wells display a green product. A precipitated product indicates...

... is better than pulling motion Take care not to split or gouge agar during the scraping process. Add each...

.... Each gene was chosen to represent the primary splice variant in 38 types of human cancer. Many of the...

...AAV8, AAV9 Table 1: Summary of tissue tropism displayed by different AAV serotypes. Pseudotypes Pseudotyping...derived from eight different serotypes. AAV-DJ displays a higher transduction efficiency in vitro than...specific cell and tissue types, like AAV-DJ8, which displays enhanced brain uptake. Systemic capsids Another...employed to engineer an rAAV serotype variant able to display neuronal retrograde transport, AAVrg. Retrograde...limitation for CRISPR delivery for more information. Split AAVs to increase packaging capacity Another strategy...derived plasmids and base/prime editors, is to create split AAVs. Here, a longer transgene is broken down between...different mechanisms. One of these methods uses splice site donor and acceptor sequences to reconstitute...

...SV40 promoter/origin Forward SV40-spliceR CACAAAGATCCGGACCAAAG SV40 splice sequence Reverse T3 GCAATTAACCCTCACTAAAGG...pGL3 vector Forward SFFV-F ATTGATTGACTGCCCACCTC Spleen focus forming virus 5' LTR Forward SP6 ATTTAGGTGACACTATAG...

...Aspergillus species. MoClo Yeast Secretion and Display (YSD) Toolkit Yeast Expression Paul Young 34 plasmids...Toolkit (YTK) to optimize secretion and cell surface display of proteins of interest. Yeast Secrete and Detect...domain, for mammalian or E. coli expression. T2A Split/Link TurboID Kit Mammalian Expression Sven Eyckerman...

... reverse transcription. The edited DNA strand displaces the unedited 5’ flap, and the resulting heteroduplex...including editors based on a second ADAR variant that displays improved specificity, and editors carrying an ... in vivo RNA imaging or to control alternative splicing. Figure 13: Overview of RNA targeting (A) and ...locus-specific targeting of long RNAs with CRISPR-Display. Nature Methods , 12 (7), 664–670. PMID: 26030444...

... Rev Response Element (RRE) within unspliced and partially spliced transcripts to facilitate nuclear export... a few key ways. First, the packaging system is split into two plasmids. Although safer, this system can...

...region is removed from the mRNA due to alternative splicing, and an early frameshift mutation is more likely...

...photocurrent amplitude 490 ChR/T159C T159C mutation; displays increased photocurrents 470 SFO/SSFO Step function...

...26–45 kb in length and contain multiple heavily-spliced transcripts flanked by two inverted terminal repeats...