We narrowed to 7 results for: SPL;
-
TypeGuide...AAV8, AAV9 Table 1: Summary of tissue tropism displayed by different AAV serotypes. Pseudotypes Pseudotyping...derived from eight different serotypes. AAV-DJ displays a higher transduction efficiency in vitro than...specific cell and tissue types, like AAV-DJ8, which displays enhanced brain uptake. Systemic capsids Another...employed to engineer an rAAV serotype variant able to display neuronal retrograde transport, AAVrg. Retrograde...limitation for CRISPR delivery for more information. Split AAVs to increase packaging capacity Another strategy...derived plasmids and base/prime editors, is to create split AAVs. Here, a longer transgene is broken down between...different mechanisms. One of these methods uses splice site donor and acceptor sequences to reconstitute...
-
Sequencing Primers
TypeGuide...promoter/origin, forward primer SV40-spliceR CACAAAGATCCGGACCAAAG SV40 splice sequence, reverse primer T3 GCAATTAACCCTCACTAAAGG...vector, forward primer SFFV-F ATTGATTGACTGCCCACCTC Spleen focus forming virus 5' LTR, forward primer SP6 ... -
Lentiviral Vector Guide
TypeGuide... Rev Response Element (RRE) within unspliced and partially spliced transcripts to facilitate nuclear export... a few key ways. First, the packaging system is split into two plasmids. Although safer, this system can... -
CRISPR Guide
TypeGuide... reverse transcription. The edited DNA strand displaces the unedited 5’ flap, and the resulting heteroduplex...including editors based on a second ADAR variant that displays improved specificity, and editors carrying an ... in vivo RNA imaging or to control alternative splicing. Figure 13: Overview of RNA targeting (A) and ...locus-specific targeting of long RNAs with CRISPR-Display. Nature Methods , 12 (7), 664–670. PMID: 26030444... -
Plan Your Experiment
TypeGuide...should be made HDR requires a repair template and displays reduced efficiency compared to NHEJ knockout. ...region is removed from the mRNA due to alternative splicing. Exons near the N-terminus are targeted since ... -
Optogenetics Guide
TypeGuide...photocurrent amplitude 490 ChR/T159C T159C mutation; displays increased photocurrents 470 SFO/SSFO Step function... -
Adenovirus Guide
TypeGuide...26–45 kb in length and contain multiple heavily-spliced transcripts flanked by two inverted terminal repeats...