Skip to main content

We narrowed to 255 results for: tre promoter

Showing: 241 - 255 of 255 results
  1. Promoters

    Type
    Guide
    ...Reference Promoters Promoters Prokaryotic Promoters Eukaryotic Promoters Resources A promoter is a region...a eukaryotic promoter: the core promoter, the proximal promoter, and the distal promoter (Figure 4). Figure...Eukaryotic Promoters Eukaryotic promoters are much more complex and diverse than prokaryotic promoters and span...bind. Distal Promoter The final portion of the promoter region is called the distal promoter, which is upstream...elongation factor promoter TRE Inducible Multiple Tetracycline response element promoter; often optimized...core promoter is the TSS, which is where transcription begins. Proximal Promoter Further upstream from... upstream of the proximal promoter. The distal promoter also contains transcription factor binding sites...
  2. Plasmids for Stem Cell Research

    Type
    Collection
    ...lentiviral plasmids The acetyllysine reader BRD3R promotes human nuclear reprogramming and regulates mitosis...Nature. 2011 Jul 13. doi: 10.1038/nature10323. Crabtree Fibroblasts Motor Neurons Retroviral Mouse/Human...
  3. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...into the p1316 plasmid that contains an upstream CMV promoter for light chain expression, and an ER signal... and heavy (blue) chains as driven by two CMV promoters (orange). Hybridoma-derived V L and V H domain...light chain polyA tail sequences (κ pA), a CMV promoter for heavy chain expression, and an ER signal/leader...DEPDC5 Human Mouse IgG2a 206594 Anti-TRESK K+ channel [N467/1R] TRESK K+ channel Mouse Mouse IgG2a 206595...Mouse IgG2a 225384 TREK-1 K+ channel (Mus musculus) recombinant monoclonal antibody. TREK-1 K+ channel Mouse...translocation of the light chain across the ER membrane. Downstream of the insert is a heavy chain constant domain...
  4. Sequencing Primers

    Type
    Guide
    ...vectors with AOX1 promoter Forward 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter Forward AC5 ACACAAAGCCGCTCCATCAG...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward M13 Forward...araBAD promoter Forward pBAD Reverse GATTTAATCTGTATCAGG For vectors with E. coli araBAD promoter Reverse... ATTTAGGTGACACTATAG SP6 promoter Forward T3 GCAATTAACCCTCACTAAAGG T3 promoter Forward T7 TAATACGACTCACTATAGGG... AUG1 promoter Forward AUG1 Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1 promoter Reverse... shock promoter Forward EF-1α Forward TCAAGCCTCAGACAGTGGTTC Human elongation factor-1α promoter Forward...cerevisiae GAL1 promoter Forward Gal10pro-F GGTGGTAATGCCATGTAATATG S. cerevisiae GAL10 promoter Forward Gal4...
  5. Molecular Biology Reference

    Type
    Guide
    ...located downstream from a promoter to drive expression of the inserted gene. Insert The gene, promoter, or.... The strength of the promoter can control the level of insert expression, as a strong promoter directs...particular plasmid. Promoter Region Drives transcription of the insert. The promoter recruits transcriptional...weaker promoters can direct low/endogenous expression levels. For more information about promoters, check...genetic element. For instance, a promoter of interest could be inserted upstream of the luciferase gene to determine...resources, including: Molecular Cloning Techniques Promoters Sequencing Primers Origins of Molecular Genetics... for a variety of studies used to investigate promoters, small RNAs, and other genetic elements. Plasmid...
  6. Modular Cloning Guide

    Type
    Guide
    ...plasmids including constitutive promoters, T7 expression, RBS strength variants, synthetic terminators...cross-compatible plasmids including 11 inducible promoters, 16 RBS strength variants, 8 tag-compatible RBSs, 2 secretion...insert fragments of DNA containing basic parts (promoters, UTRs, coding sequences, terminators, etc.) flanked... a single transcriptional unit (for example, a promoter, a 5' UTR, a signal peptide, a protein-coding ... nucleases, base editors, gRNA backbones, and promoters for genome editing in monocots and dicots. pDGE...PI Description MoClo Toolkit Plant Expression Sylvestre Marillonnet 95 plasmids for cloning and assembling...interest. Yeast Secrete and Detect Yeast Expression Sylvestre Marillonnet Plasmids to generate transcription...
  7. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...heterologous promoter (usually CMV or RSV). 5' LTR in cis Acts as an RNA pol II promoter; the transcript... to prefer transcription start sites, such as promoters and enhancers. Many times, integration sites are...cell lines, VSV-G is often put under an inducible promoter. Depending on the cell type, there are other envelope...selection is driven by strong enhancers and active promoters. Nucleic Acids Research , 42 (7), 4257–4269. https...plasmids use a hybrid 5' LTR with a constitutive promoter such as CMV or RSV. 3' LTR in cis Terminates transcription...stable delivery of various genes, mutations, or treatments into cells, and has been widely used in the research...many approved gamma-retroviral gene therapies to treat disease like cancer or immunodeficiency disorders...
  8. Lentiviral Vector Guide

    Type
    Guide
    ...LTR for self-inactivation LTR Viral Promoter Wildtype Hybrid promoter; 5' LTR is partially deleted and fused...with a heterologous promoter (CMV or RSV). 5' LTR in cis Acts as an RNA pol II promoter; the transcript begins...plasmids include tat , as the 5’ LTR is used as a promoter on the transfer plasmid, and this requires Tat...contains a chimeric 5’ LTR fused to a heterologous promoter (often CMV or RSV), eliminating the need for transactivation... fused to a heterologous enhancer/promoter such as CMV or RSV Table 1. Summary of key differences between...cell lines, VSV-G is often put under an inducible promoter. Depending on the cell type, there are other envelope... mitigated through the use of tissue-specific promoters and envelope genes, and/or with site-specific ...
  9. Plan Your Experiment

    Type
    Guide
    ...template Cas9 or Cas9 fusions with proteins that promote HDR Requires a repair template Lower editing efficiency...prime editing. CRISPR Intereference : Target the promoter region of the gene of interest, where the Cas9...approaches, the species and expression pattern of the promoter for both your Cas enzyme and gRNA and the presence...the wide range of options for the Cas enzyme, promoters, and selection markers. There are also no packaging...to specific cell types by using cell-specific promoters, which is useful for in vivo studies. While we...transfect, transduce, or may not express common promoters. Browse Cas9 plasmids for RNP delivery . As mentioned...protein product. Be aware that there could be downstream translation start sites that could allow for ...
  10. Chemogenetics Guide

    Type
    Guide
    ...commercially available. Table 4: Common promoters in chemogenetics plasmids Promoter Cell Specificity hSyn1, CaMKIIa...controlled with cell-type specific promoters. Table 4 lists some common promoters found in chemogenetic receptor...binding then activates G-proteins to modulate downstream signaling. GPCRs have been shown to be involved...signaling by inhibiting adenylate cyclase and downstream cAMP production. There are currently two Gi DREADDs...Silvagnoli, A. D., Crespo, E. L., Schalau, R., Gott, M., Tree, M. O., Dunbar, G. L., Rossignol, J., & Hochgeschwender...N., Simkins, J., Crespo, E. L., Ikefuama, E. C., Tree, M. O., Prakash, M., Björefeldt, A., Barnett, L....
  11. CRISPR Guide

    Type
    Guide
    ...are often used to change an amino acid, turn a promoter on/off, or add small protein tags. Precise Modifications... editors include several fused components that promote the intended repair pathway or inhibit unwanted... converting cytidine to uridine. However, they promote the base excision repair pathway, which fully removes...improved PE2/PE3 to inhibit mismatch repair to promote desired edit epegRNA — addition of a structured...while activation and repression libraries target promoter or enhancer regions. As each library is unique...transcriptional repressors or activators and targeting promoter regions. You might sometimes see these referred...the methylation state of cytosines in a gene’s promoter or by inducing histone acetylation or demethylation...
  12. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ... proteins, often under strong neuron-specific promoters or neural Cre-dependent expression, to visualize...recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis...nuclear export of RNA and RNA translation, and promotes RNA transcript longevity. Located between WPRE...rAAV vectors is in the field of gene therapy to treat genetic disorders. rAAV vectors are favored over...by the US Food and Drug Administration (FDA) to treat a diversity of diseases such as inherited retinal...therapies are underway and are promising for the treatment of other major diseases such as cystic fibrosis...CRISPR-based genome editing. Packaging the Cas9 from Streptococcus pyogenes (SpCas9) and a gRNA together into an...
  13. Immunology Research Plasmids and Resources

    Type
    Collection
    ... MCH2, MCH2R, SLT MDK midkine (neurite growth-promoting factor 2) FLJ27379, MK, NEGF2 MET met proto-oncogene... different fluorescent proteins, 10 mammalian promoters and enhancers, 3 polyA signals as well as selection...antigens through the B cell receptor (BCR). The strength and duration of signaling controls the fate of...Growth Factor beta (TGFbeta) signaling and its downstream effector molecules, the Smad proteins, regulate...KIAA0403, LMOR, MOR, MOR1, OPRM OSGIN1 oxidative stress induced growth inhibitor 1 BDGI, OKL38 OSM oncostatin...SRP, UCN-II, UCNI, UR, URP UCN3 urocortin 3 (stresscopin) MGC119002, SCP, SPC, UCNIII UTS2 urotensin 2...
  14. Adenovirus Guide

    Type
    Guide
    ... Repeat, serve as self-priming structures that promote primase-independent DNA replication. 3' ITR (RITR... Repeat, serve as self-priming structures that promote primase-independent DNA replication. Homology arms...infectious diseases and prostate cancer. Cancer Treatment Recombinant adenoviral vectors are also being ...
  15. Molecular Cloning Techniques

    Type
    Guide
    ...and Gateway destination vectors with different promoters, tags, selection markers, and fluorescent proteins...restriction site. Because of the relatively long stretches of base pairing in the annealed product, ligation...
Showing: 241 - 255 of 255 results