We narrowed to 938 results for: Kin
-
TypeGuide...promoter, forward primer pcDL-F GTTGCCTTTACTTCTAGGCCT (Kinet lab) 5' of EcoRI site in pcDL vector, forward primer...reverse primer TK-pA-R TTGTCTCCTTCCGTGTTTCA Thymidine kinase polyA, reverse primer Tn7-end GGGGTGGAAATGGAGTTTTT...TATGGCTAGCATGACTGGT (Invitrogen) Xpress epitope, forward primer Looking for Primers? The primer sequences listed are provided...
-
Cloning
TypeGuide... The entry clone now has recombined attL sites flanking your DNA fragment of interest. Now that your DNA...site-specific recombination or a ligation step, making it an easy, cheap and rapid cloning method. So ... -
Gamma-Retroviral Vector Guide
TypeGuide...necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular Biology...occur with contact to mucous membranes or broken skin. Needle sticks and ripped gloves are common points... -
Lentiviral Vector Guide
TypeGuide...necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular Biology...occur with contact to mucous membranes or broken skin. Needle sticks and ripped gloves are common points... -
Promoters
TypeGuide...Constitutive Mammalian promoter from phospholycerate kinase gene TRE Inducible Tetracycline response element... -
Modular Cloning Guide
TypeGuide...integrative or self-replicating plasmid vectors for working in cyanobacteria. Cultivarium POSSUM Toolkit Bacterial... -
Immunocytochemistry
TypeProtocol...PBS on a rocking platform. Permeabilize cells for 10 min at room temperature ( RT ) on a rocking platform...PBS on a rocking platform. Section 3: Labeling with antibody Block for 20 min at RT on a rocking platform...platform in 500 µL blocking buffer. Remove the blocking buffer and dispose of it in an appropriate waste container...PBS on a rocking platform. (Optional) Counterstain nuclei with 500 µL of 300 nM DAPI working solution ...Equipment Pipette controller Pipette tips and pipettes Rocking platform Tweezers Fluorescent microscope 0.5–10...buffer: Dilute 20 µL of Triton X-100 in 10 mL PBS. Blocking buffer: Dilute 0.5 g BSA and 30 µL Triton X-100... 150 µL Triton X-100 in 50 mL PBS. 300 nM DAPI working solution: Prepare a 300 µM DAPI stock solution ... -
Western Blot
TypeProtocol...side up. Block the membrane in blocking buffer for 1 h at RT on a shaking platform. Wash the membrane 3x... at RT on a shaking platform. Wash the membrane 3x for 5 min in 1X TBST at RT on a shaking platform. Prepare...information specific to your antibody, such as ideal blocking buffer and optimal antibody concentrations. Consider...When the run is complete, select Done. Section 5: Blocking Prepare 1X TBST as follows: 25 mL of 20X TBS 2.5...20 472.5 mL of deionized water Mix well Prepare blocking buffer as follows: Dilute 5% w/v non-fat milk ...milk into 100 mL of 1X TBST. Pro-Tip The ideal blocking buffer will vary between antibodies. Refer to ... 3x for 5 min in 1X TBST at RT on a shaking platform. Section 6: Antibody incubation Dilute the primary... -
Lab Safety for Biosafety Levels One and Two
TypeProtocol... some times when you may be working with a protocol that requires shaking or mixing, which may produce...safety guidelines provide steps to ensure you are working in BSL-1 and BSL-2 labs safely. Protocols...safety requirements. BSL-1 is designated for those working with microbes that don’t cause disease in healthy...equipment (PPE) and wear it the whole time you are working in the lab. Do not eat, drink, chew gum, or apply...work at your lab bench. It’s possible that while working, you may accidentally come into contact with hazardous...into your eyes. Wash your hands before and after working in the lab. Ensure that a designated chemical waste...safety training before starting the work. Before working with chemicals, first review their material safety... -
Video Library
TypeProtocol...Protocol Streaking Bacteria on Plates Isolate single bacterial colonies on an agar plate Streaking Bacteria...new window) Video Link Description Related Page Making LB Agar Plates Create plates to culture bacteria...Started with Tissue Culture Tips and tricks for working with tissue culture in the lab. Blog post: 10 Basic...clean workspace, and maintaining sterility while working. AAV Titration by qPCR Use qPCR to measure the ...students considering their future careers. Eric J. Perkins, PhD In this installment, we sit down with Senior...Senior Scientific Project Leader Eric Perkins to discuss the various positions he has held in his career...the works, and all of the things she loves about working at Addgene! Maria Soriano Maria Soriano, from Addgene's...