We narrowed to 13 results for: Kin
-
TypeGuide...mutations to alter the absorption spectrum or adding trafficking signals to localize opsins to the cell membrane...research, helping scientists to better understand Parkinson’s disease, depression, drug addiction, and more...), C1V1(t/t), ChIEF Increased channel (on/off) kinetics: Examples: ChETA, C1V1(t/t), ChrimsonR Red-shifted...CrChR2 450 ChETA E123T mutation; creates faster kinetics but reduces photocurrent amplitude 490 ChR/T159C...activity 589 eNpHR 3.0 NpHR with addition of trafficking signal from Kir2.1 and ER export signal provide...sodomense 566 eArch 3.0 Arch with addition of trafficking signal from Kir2.1 566 ArchT Light-activated ... Arch. 566 eArchT 3.0 ArchT with addition of trafficking signal from Kir2.1 566 Leptosphaeria rhodopsins...
-
Molecular Biology Reference
TypeGuide...Origins of Molecular Genetics Plasmid Elements Working with Plasmids Introduction Types of Plasmids E....to break chromosomes down to study their genes, marking the birth of molecular genetics. Today, scientists...primers check out Addgene's sequencing primer list. Working with Plasmids Plasmids have become an essential...entry vectors and TOPO cloning vectors. If you are looking for an empty plasmid backbone for your experiment... number of E. coli strains below and recommend checking out these two Addgene blog posts relating to common...and their recommended concentrations. We suggest checking your plasmid's datasheet or the plasmid map to...Antibiotic Recommended Stock Concentration Recommended Working Concentration Ampicillin 100 mg/mL 100 µg/mL Carbenicillin... -
CRISPR Guide
TypeGuide...dynamic tracking of repetitive and non-repetitive genomic loci, chromosome painting, and RNA tracking in living... the most scalable genome editing technologies, making CRISPR perfect for genome-wide screens. This guide...very close proximity to the region to be edited, making the PAM sequence (NGG) limiting. This PAM is abundant...inhibit CRISPR by a variety of mechanisms, including blocking crRNA loading or PAM recognition; inhibiting Cas9...sites is sufficient to repress transcription by blocking initiation. More robust transcriptional repression...repression through cytosine methylation with improved kinetics LSD1 - repression through targeted removal of ...proteins that target RNA instead of DNA enables tracking of RNA in live cells, including orthogonal RNA... -
Chemogenetics Guide
TypeGuide...exhibited high levels of constitutive activity, making them less than ideal. DREADDs Designer Receptors... previously used in human populations in Japan, making it an attractive option for translational studies...engineered to respond specifically to the anti-smoking drug varenicline. This PSAM carries mutations at... workflows (such as laser or LED illumination), making LMOs a versatile option. Coupling brighter bioluminescent...antipsychotic drugs: is M1 agonism a pre-requisite for mimicking clozapine’s actions? Psychopharmacology. 178:451...opens in a new window) Slaviero AN, Gorantla N, Simkins J, Crespo EL, Ikefuama EC, Tree MO, Prakash M, ... -
Adenovirus Guide
TypeGuide...necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular Biology...response in different ways, such as expressing cytokines and other immune-modulatory molecules. Another...occur with contact to mucous membranes or broken skin. The risk of exposure and reaction severity is increased... He, T. C., Zhou, S., da Costa, L. T., Yu, J., Kinzler, K. W., & Vogelstein, B. (1998). A simplified system... J., Sharff, K. A., Luu, H. H., Haydon, R. C., Kinzler, K. W., Vogelstein, B., & He, T. C. (2007). A protocol... -
Antibody Guide
TypeGuide...important factor (for instance, looking for a different conjugate or looking for antibodies validated for...unused surface-binding sites in the wells with a blocking protein such as BSA, followed by several wash ... assay, called native ChIP, does not use cross-linking and instead relies on strong interactions between...the product information for similar antibodies, looking for ones that have identical features and epitopes... -
Plan Your Experiment
TypeGuide...setting up CRISPR experiments. We will focus on making single edits using CRISPR/Cas9 in mammalian cells...experiments and can be used as positive controls when working out a new protocol. Read more about how to design... the cell type. Before proceeding, we recommend asking labmates/colleagues, searching the literature, ...efficiency. Edit Type The type of edit you are looking for will ultimately depend on which CRISPR method... -
Adeno-associated virus (AAV) Guide
TypeGuide...necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular Biology...choice for the delivery of CRISPR/Cas9 elements, making it one of the most common methods for in vivo CRISPR-based...occur with contact to mucous membranes or broken skin. Needle sticks and ripped gloves are common points...pioneering solutions for human genetic diseases . Cytokine & Growth Factor Reviews, 80 , 109–120. https:/... -
Sequencing Primers
TypeGuide...Reference Sequencing Primers Sequencing Primers Looking for Primers? The primer sequences listed on the...promoter, forward primer pcDL-F GTTGCCTTTACTTCTAGGCCT (Kinet lab) 5' of EcoRI site in pcDL vector, forward primer...reverse primer TK-pA-R TTGTCTCCTTCCGTGTTTCA Thymidine kinase polyA, reverse primer Tn7-end GGGGTGGAAATGGAGTTTTT... -
Cloning
TypeGuide... The entry clone now has recombined attL sites flanking your DNA fragment of interest. Now that your DNA...site-specific recombination or a ligation step, making it an easy, cheap and rapid cloning method. So ... -
Gamma-Retroviral Vector Guide
TypeGuide...necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular Biology...occur with contact to mucous membranes or broken skin. Needle sticks and ripped gloves are common points... -
Lentiviral Vector Guide
TypeGuide...necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular Biology...occur with contact to mucous membranes or broken skin. Needle sticks and ripped gloves are common points... -
Promoters
TypeGuide...Constitutive Mammalian promoter from phospholycerate kinase gene TRE Inducible Tetracycline response element...