...pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1 HTT GFP U6, EFS Huntington's Nicole Deglon 190903 pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1...

...159 (3), 647–661. PMID: 25307932 Hilton, I. B., D’Ippolito, A. M., Vockley, C. M., Thakore, P. I., Crawford...

...because they control the binding of RNA polymerase to DNA. RNA polymerase transcribes DNA to mRNA which is ultimately... factors in order for RNA polymerase II (a eukaryote-specific RNA polymerase) to bind to a promoter. Transcription...the RNA polymerase binding site, TATA box, and transcription start site (TSS). RNA polymerase will bind...binding of the RNA polymerase. A transcription complex is constructed from the RNA polymerase and several transcription...T7 RNA polymerase Promoter from T7 bacteriophage Sp6 Constitutive but requires Sp6 RNA polymerase Promoter...and trp Types of RNA Polymerases Promoters control the binding of RNA polymerase to DNA to initiate the...three types of RNA polymerases that all transcribe different genes. RNA polymerase I transcribes genes...

...and thymine (T). TOPO® cloning utilizes the Taq polymerase which naturally leaves a single adenosine (A)...Additionally, the efficiency can vary depending on the polymerase used, and the single A overhangs degrade over...common molecular biology enzymes: 5' exonuclease, polymerase and ligase. 5' exonuclease digests the 5' end...to generate 3' single-stranded overhangs. DNA polymerases synthesize DNA molecules using the 4 nucleotides...anneal to each other due to their homology. DNA polymerase then closes the gap created by the 5’ exonuclease...relies on the 3'-5' exonuclease activity of T4 DNA polymerase. An exonuclease is an enzyme which removes nucleotides... the end of a DNA strand. In LIC, the T4 DNA polymerase’s exonuclease activity creates “chewed-back” overhangs...

...vector, forward primer Polyhedrin forward AAATGATAACCATCTCGC (Invitrogen) Polyhedrin promoter, forward primer...primer Polyhedrin reverse GTCCAAGTTTCCCTG (Invitrogen) For baculovirus vector with polyhedrin promoter...Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region, reverse primer CAT-R GCAACTGACTGAAATGCCTC... Reverse GTGGTTTGTCCAAACTCATC (Invitrogen) SV40 polyA terminator, reverse primer Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC...forward primer SV40pA-R GAAATTTGTGATGCTATTGC SV40 polyA, reverse primer SV40pro-F TATTTATGCAGAGGCCGAGG SV40...primer TK-pA-R TTGTCTCCTTCCGTGTTTCA Thymidine kinase polyA, reverse primer Tn7-end GGGGTGGAAATGGAGTTTTT Bacterial...

...lower background signals than polyclonal antibodies. However, polyclonal antibodies are more sensitive...clone that are specific to a certain epitope, or polyclonal, meaning there are many clones that are specific... antibodies are typically more expensive than polyclonal antibodies. Environmental factors, binding partners...available epitope on your protein of interest. Polyclonal antibodies are typically collected directly from...targeting various epitopes on the same antigen. Polyclonal antibodies are often more environmentally stable...protein in any form it may be present in. However, polyclonals can vary significantly from lot to lot, as immune...consider the following questions: Do you need polyclonal or monoclonal antibodies? Will you be using a...

...DNA polymerase adding nucleotides. The major difference in this process occurs when the polymerase incorporates.... During replication, DNA unwinds and the DNA polymerase enzyme binds to and migrates down the single ...replication requires the 4 nucleotides, a DNA polymerase enzyme, the template DNA to be copied, and a ... DNA and acts as a starting point for the DNA polymerase. Thus to replicate a piece of DNA in vitro one...

... DMEM complete + 10 µg/mL polybrene by diluting 20 µL of 10 mg/mL polybrene into 20 mL media. Thaw the...with DMEM complete + 10 µg/mL polybrene, the final concentration of polybrene in each well should be 10 µg...cells, resulting in a more homogenous (but still polyclonal) cell population. Depending on the transducibility...glutaGRO, Corning 25-015-CI) Heat-inactivated FBS Polybrene (10 mg/mL), Millipore TR-1003-G 1X PBS pH 7.4 ... the attachment of adherent cells) 0.45 μm polyethersulfone filter, Nalgene, 565-0010 (for viral preps...of the lentivirus in DMEM complete + 10 µg/mL polybrene. Note, this is just a sample of possible dilutions...Lentivirus (μL) Volume of DMEM complete + 10 µg/mL polybrene (µL) 0 0 500 1:5 300 200 1:10 150 350 1:50 30 ...

...μg/mL polybrene. TIP: Polybrene increases the efficiency of viral infection. However, polybrene is toxic...drives RNA Polymerase III transcription for generation of shRNA transcripts. cPPT Central polypurine tract,...especially repeated Ts because polyT is a termination signal for RNA polymerase III. Note that these were ... for 12-15 hours. c. In polypropylene microfuge tubes (do NOT use polystyrene tubes), make a cocktail .... Hexadimethrine Bromide (Polybrene) Prepare a 1mg/mL solution of polybrene (Sigma-Aldrich catalog #H9268...to adjust the sequencing conditions if the DNA polymerase has difficulty reading through the secondary ...Penicillin/Streptomycin Invitrogen: #15140-122 Polypropylene tubes VWR: #87003-290 Note: pLKO.1 could also...

...complete containing 10 μg/mL polybrene by diluting 20 μL of 10 mg/mL polybrene into 20 mL of media. If using...glutaGRO, Corning 25-015-CI) Heat-inactivated FBS Polybrene (10 mg/mL), Millipore TR-1003-G 1X PBS pH 7.4 ... mL luer-lock syringe, BD BD300912 0.45 μm polyethersulfone filter, Nalgene, 565-0010 (for viral preps... before transduction. Note that in that case, polybrene should only be added at the time of viral transduction... collected virus, filter through a 0.45 μm polyethersulfone filter to remove cells and debris. Lentiviral...lentivirus into DMEM complete containing 10 μg/mL polybrene: Dilution Volume of Lentivirus or Previous Dilution...) Volume of DMEM Complete Containing 10 μg/mL Polybrene (μL) Volume of Virus Added to Plate (μL) Volume...

...ligation. Because of its dual polymerase/exonuclease functions, T4 DNA polymerase can create overhangs of varying... Because the polymerase reaction is favored over the exonuclease reaction, the polymerase will add back... of the enzyme and shift its activity back to polymerase. In our case, dGTP will be used in the reaction...Overhangs Treat the linearized vector with T4 DNA polymerase to "chew back" the free 3' ends, following the... (exclude all other nucleotides from standard polymerase protocol), causing the enzyme to perform exonuclease...mM) 5 mM 1 BSA (10 μg/μl) 0.25 μg/μl 1 T4 DNA polymerase 0.075 units/μl sterile dH20 to 40 μl Step 4: ...insert following the instructions provided by your polymerase manufacturer. It is very important to remove ...

...how to generate a monoclonal cell line from a polyclonal pool of stable cells....how to generate a monoclonal cell line from a polyclonal pool of stable cells. Transducing cells with ...with lentivirus results in a heterogenous polyclonal population that varies in the number of integration ... as the lower expressing clones take over the polyclonal cell pool. Generating a monoclonal cell line ... Hemocytometer or other cell counter Reagents Polyclonal stable cell pool DMEM high glucose, Corning 10...Corning 3516 96-well plate, Corning 3596 0.45 μm polyethersulfone filter, Nalgene, 565-0010 (optional) 40 µm...FBS and 5 mL of 100X glutaGRO. Store at 4 °C. Polyclonal stable cell pool: see our protocol for generating...

...vector transfected into 293T cells using a polyethylenimine (PEI) transfection protocol. This procedure... Thermo Fisher, 12309019 25 mM chloroquine Polyethylenimine, linear MW 25,000 Da Heat-inactivated FBS ... the attachment of adherent cells) 0.45 μm polyethersulfone filter, Nalgene, 565-0010 Microcentrifuge ...Hydrochloric acid Sodium hydroxide 0.22 μm polyethersulfone (PES) filter Transfection grade DNAs: Lentiviral...lab by heating to 56°C for 30 min. 1 mg/mL polyethylenimine, linear MW 25,000 Da (PEI) Dissolve 100 mg...harvests, transfer the harvested media to a polypropylene storage tube and store at 4 °C between harvest...

...EX0276-1 Benzonase 250 U/µl, Millipore #71205-3 Polybrene 10 mg/mL, Millipore, TR-1003-G Molecular Biology... Pierceable foil heat seal, Bio-Rad, 1814040 Polystyrene reservoirs, VWR, 89094-662 Microcentrifuge tubes...300,000 cells/well in 1350 µL media and 11.1 µg/mL Polybrene into the wells containing the virus and the untransduced...,000 cells in 13.5 mL of media and 11.1 µg/mL Polybrene. Mix the cell suspension well before seeding. ...final volume in the well is 1.5 mL, and the final Polybrene concentration is 10 µg/mL. Mix well and incubate...cartridge. Add 800 µL of droplet generation oil to a polystyrene reagent reservoir. Using the 20–200 µL multichannel...

...glutaGRO, Corning 25-015-CI) Heat-inactivated FBS Polybrene (10mg/mL), Millipore TR-1003-G 1X PBS pH 7.4 without... the attachment of adherent cells) 0.45 μm polyethersulfone filter, Nalgene, 565-0010 (for viral preps... collected virus, filter through a 0.45 μm polyethersulfone filter to remove cells and debris. Lentiviral...lentivirus into DMEM complete containing 10 μg/mL polybrene. Note, this protocol was developed using low titer...Volume of DMEM complete (μL) Volume of 10mg/mL polybrene (μL) 1:10 150 1348.5 1.5 1:25 60 1438.5 1.5 1:...

...by heating to 56 °C for 30 minutes. 0.45 μm polyethersulfone (PES) filter system, Nalgene, 565-0010 (or... the attachment of adherent cells) 1 mg/mL Polyethylenimine (PEI) 25 kDa MW Pro-Tip Other transfection...100 Benzonase/DNAse I (Millipore 71205-3) 40% Polyethylene Glycol 8000 (PEG) + 0.5 M NaCl Cell lysis buffer...HEPES to 750 mL DMEM + 1 g/L glucose. 1 mg/mL polyethylenimine (PEI) solution: Dissolve 100 mg of PEI powder...discard the tube and thaw a new working stock. 40% POLYETHYLENE GLYCOL (PEG) 8000 solution: Dissolve 400 g of...

...plasmid using restriction enzymes Watch the Video! Polymerase Chain Reaction (PCR) Basic PCR protocol with ...cloning with Type II restriction enzymes and T4 polymerase pLKO.1 - TRC Cloning Vector Cloning protocols...Lentivirus Production Produce lentivirus with a polyethyenimine (PEI) transfection protocol Fluorescence Titering...Dilution Generate monoclonal cell lines from a polyclonal pool of stable cells AAV Production in HEK293...

... transfecting mammalian cells using linear polyethylenimine. Transfections allow for transient expression... Thermo Fisher, 12309019 25 mM chloroquine Polyethylenimine, linear MW 25,000 Da Microcentrifuge tubes...Hydrochloric acid Sodium hydroxide 0.22 μm polyethersulfone (PES) filter Syringes for filtering Reagent...should be discarded after 1–2 months. 1 mg/mL polyethylenimine, linear MW 25,000 Da (PEI) Dissolve 100 mg...

... high fidelity taq polymerase to minimize mutations. The fidelity of the polymerase becomes more important...bp depending on the polymerase used. Because of this, no matter which taq polymerase you use, it is important...

...1814040 Microseal adhesive seal, Bio-Rad, MSB1001 Polystyrene Reservoirs, VWR, 89094-662 Microcentrifuge tubes... the NTC. Pour the 1X dilution buffer into a polystyrene reagent reservoir. Using a 20–200 µL multichannel...cartridge. Add 800 µL of droplet generation oil to a polystyrene reagent reservoir. Using the 20–200 µL multichannel...