We narrowed to 11 results for: poly

...increased nuclear export. Poly(A) signal in cis The polyadenylation or poly(A) signal aids in the nuclear...vector capsid. Icosahedral Having the shape of a polyhedron with 20 faces, each being an equilateral triangle...

...they control the binding of the RNA polymerase to DNA. RNA polymerase transcribes DNA to mRNA, which is ... factors in order for RNA polymerase II (a eukaryote-specific RNA polymerase) to bind to a promoter. Transcription...T7 RNA polymerase Sp6 Constitutive Promoter from Sp6 bacteriophage; requires Sp6 RNA polymerase lac Constitutive... and contains the RNA polymerase binding site, TATA box, and TSS. RNA polymerase will stably bind to this...systems Types of RNA Polymerases Promoters control the binding of RNA polymerase to DNA to initiate the...three types of RNA polymerases that all transcribe different genes: RNA polymerase I — transcribes genes... is the strand that is transcribed by the RNA polymerase. Figure 1: Simplified promoter region during ...

...vector Forward Polyhedrin forward AAATGATAACCATCTCGC Polyhedrin promoter Forward Polyhedrin reverse GTCCAAGTTTCCCTG...Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region Reverse CAT-R GCAACTGACTGAAATGCCTC 5' end...DsRed1 Reverse EBV Reverse GTGGTTTGTCCAAACTCATC SV40 polyA terminator Reverse Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC...GTCCAAGTTTCCCTG For baculovirus vector with polyhedrin promoter Reverse pQE promoter CCCGAAAAGTGCCACCTG ...promoter Forward SV40pA-R GAAATTTGTGATGCTATTGC SV40 polyA Reverse SV40pro-F TATTTATGCAGAGGCCGAGG SV40 promoter...Reverse TK-pA-R TTGTCTCCTTCCGTGTTTCA Thymidine kinase polyA Reverse Tn7-end GGGGTGGAAATGGAGTTTTT Bacteria transposon...

...exonuclease activity of T4 DNA polymerase. In LIC, the T4 DNA polymerase’s exonuclease activity creates ...and thymine (T). TOPO cloning utilizes the Taq polymerase, which naturally leaves a single A overhang on...Additionally, the efficiency can vary depending on the polymerase used, and the single A overhangs degrade over...common molecular biology enzymes: 5' exonuclease, polymerase, and ligase. In Gibson assembly, DNA fragments...each other due to their homology. Second, DNA polymerase then closes the gap created by the 5’ exonuclease...reaction. In the presence of a single free dNTP, T4 polymerase will continue to function as an exonuclease until...complementary to the free nucleotide. T4 will resume its polymerase activity, add back the free base, and become ...

...lower background signals than polyclonal antibodies. However, polyclonal antibodies are more sensitive...clone that are specific to a certain epitope, or polyclonal, meaning there are many clones that are specific... antibodies are typically more expensive than polyclonal antibodies. Environmental factors, binding partners...available epitope on your protein of interest. Polyclonal antibodies are typically collected directly from...targeting various epitopes on the same antigen. Polyclonal antibodies are often more environmentally stable...protein in any form it may be present in. However, polyclonals can vary significantly from lot to lot, as immune...consider the following questions: Do you need polyclonal or monoclonal antibodies? Will you be using a...

... DNA polymerase then binds to the single strand of DNA. Using this as a template, the polymerase migrates... requires the four nucleotides (dNTPs), a DNA polymerase enzyme, the template DNA to be copied, and a ... DNA and acts as a starting point for the DNA polymerase. Thus to replicate a piece of DNA in vitro, you...

...with up to eight transcription units. Yarrowia lipolytica Golden Gate tool kit Yeast Expression Tristan...transcription units in the oleaginous yeast Y. lipolytica . EXPRESSYALI Yeast Expression Irina Borodina...multi-gene constructs for integration into Y. lipolytica chromosomal loci. Yeast GPCR-sensor Toolkit Yeast...

...transcription started by 5' LTR by the addition of a polyA tract just after the R sequence. WPRE in cis Woodchuck...efficient viral packaging. cPPT in cis Central polypurine tract; recognition site for proviral DNA synthesis...

...transcription started by 5' LTR by the addition of a polyA tract just after the R sequence. WPRE in cis Woodchuck...efficient viral packaging. cPPT in cis Central polypurine tract; recognition site for proviral DNA synthesis...

...vector capsid. Icosahedral Having the shape of a polyhedron with 20 faces, each being an equilateral triangle...

...j.cell.2014.09.029 PMID: 25307932 Hilton, I. B., D’Ippolito, A. M., Vockley, C. M., Thakore, P. I., Crawford...