We narrowed to 290 results for: Ott
-
TypeProtocol...appropriately sized bottle for autoclaving. We make 400 mL of agar in 1 L bottles and 200 mL of agar in...to the same bottle and swirl to form a medium/agar colloid. Cover the opening of the bottle with its cap...Use lab tape to label the bottle with your initials, the date, and the bottle contents. This will clear... in 500 mL bottles. The extra empty volume is necessary to prevent your molten agar from boiling over ...but do not make an air-tight seal!) and tape the bottle with autoclave tape. The autoclave tape will darken...clear up any confusion later if your forget your bottle in the autoclave. Place the gel mix in the autoclave...pouring your plates - be sure to leave room for your bottle of molten gel mix, a tube rack containing the appropriate...
-
AAV Production in HEK293 Cells
TypeProtocol...a sterile 250 mL bottle. Aliquot 774 mL of DMEM + 2% HI-FBS into a sterile 1 L bottle. Add each plasmid...stable alternative, such as glutaGRO) To a 500 mL bottle of DMEM high glucose, add 55 mL of heat-inactivated... mM MgCl 2 Add the following to the 2 L sterile bottle: 1836 mL deionized water + 100 mL of 1 M Tris HCl...Chloride + 4 mL of 1 M Magnesium Chloride Close the bottle and mix by inverting multiple times Adjust pH to...complete media, then transfer the cells into a sterile bottle. Rinse the CS2 with 100 mL of DMEM complete medium...plasmid DNA into the bottle containing the Opti-MEM. Mix well. Add 4 mL of PEI (1:2 μg DNA to μg PEI ratio...ratio). Shake the bottle up/down vigorously for 30 sec (it’s okay to make bubbles). Incubate at RT for 15... -
Western Blot
TypeProtocol...separator. Keep the Bottom Stack in the plastic tray. Place the Bottom Stack on the blotting surface. Align...lysate, running a precast SDS-PAGE gel, and immunoblotting. Protocols...lysate, running a precast SDS-PAGE gel, and immunoblotting. Sharing speeds science. We believe that sharing... gels. Use lower percentage acrylamide when immunoblotting high molecular weight proteins and higher percentage... percentage acrylamide when immunoblotting low molecular weight proteins. This protocol uses a dry transfer...instructional video to learn how to use western blotting to visualize a protein from cells or tissue samples...Align the electrical contacts on the blotting surface of the iBlot 2 Gel Transfer Device. Wet the pre-run... -
Water Bath Protocol
TypeProtocol...water bath weights can hold bottles in place. After putting your tubes or bottles in the water bath, place...baths that exist as scientists work with tubes and bottles of different sizes in the lab. Some water baths...water baths hold many liters of water to incubate bottles and containers. Water baths can also be placed ...be used in water baths with instructions on the bottle, for example, number of drops per liter. Place ...floating, you do not need to necessarily maneuver the bottles or tubes to identify them. Once the water bath ...temperature, remove the lid and place your tubes or bottles into the water bath. Many items may float in the... -
Pipetting Protocol
TypeProtocol...Containers to hold measured liquid (ex: microfuge tube, bottle, etc.) Labels for containers Reagents Liquid for...the the pipette, and the tip ejector ring at the bottom which pushes the pipette tip off of the pipette...Therefore, 1000 µL would read as 100 from top to bottom (as shown in the picture above), while 650 µL would... Therefore 100 µL would read as 100 from top to bottom (as shown in the picture above), while 95 µL would...pipettes will also have small tick marks at the bottom. For the P1000, this represents the ones. For the...measured liquid (ex: another microcentrifuge tube, a bottle etc.). If there is already other liquid in the ...this is a new container, place the tip near the bottom of and gently in contact with the container (capillary... -
Protocol - How to Inoculate a Bacterial Culture
TypeProtocol... growth (bottom) Loosely close the cap on the bottle (do NOT close all the way or the bottle may explode...LB, weigh out the following into a 500 mL glass bottle: 4 g NaCl 4 g Tryptone 2 g Yeast Extract and dH...!) and then loosely cover the entire top of the bottle with aluminum foil. Autoclave and allow to cool...to room temperature. Now screw on the top of the bottle and store the LB at room temperature. When ready... -
Plasmid Modification by Annealed Oligo Cloning (with Protocols)
TypeProtocol...TTAATTAA , AscI - GGCGCGCC , MfeI - CAATTG ). The bottom oligo will be the reverse compliment so that they... - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo: 3' - GTATAC AATTAATT CCGCGCGG GTTAAC - 5... the top oligo and 3' - G and CAGCT - 5' to the bottom oligo, making our final oligos 34 bp each: Top ... - AATTC CATATG TTAATTAA GGCGCGCC CAATTG G - 3' Bottom oligo: 3' - G GTATAC AATTAATT CCGCGCGG GTTAAC CAGCT...oligo: 5' - AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG ... -
Affinity Purification of Recombinant Antibodies with Protein A or Protein G
TypeProtocol...pH 9.0, Millipore Sigma T2819-1L 250 mL sterile bottle, VWR 430281 0.45 µm PES complete filtration unit...clamp on a clamp stand. Use scissors to cut the bottom of the Gravitrap column at the indentation in the...Gravitrap column. Collect the flow through in a 250 mL bottle. Repeat steps 9–10 such that the supernatant passes...microcentrifuge tubes. Cap the Gravitrap columns at the bottom. Add 5 mL of Pierce IgG Elution Buffer to the capped...Twist off the 10 mL Zeba Spin Desalting Column’s bottom closure and loosen cap. Place column in a 50 mL... -
Kit Free RNA Extraction
TypeProtocol...new RNAse-free tube. The mixture separates into a bottom organic layer, an interphase layer, and a top, ... be a gel-like white pellet of total RNA in the bottom of the tube. Wash the RNA by resuspending the pellet..., aqueous layer. If using TRIzol®, the bottom layer will be a red-pink color. Take care to not disturb... -
Coomassie Purity Stain of Recombinant Antibodies
TypeProtocol...X PBS, 1X pH 7.4, VWR 45000-446 250 mL sterile bottles, Corning 430281 Deionized water IgG isotype standard...deionized water. Gently remove the white sticker on the bottom of the gel. Place the gel in the electrophoresis...Use a razor blade to cut the top of the wells and bottom part of the gel where dye is visible. Section 2... protein band. Use the line tool to connect the bottom of each peak. Select the wand tool. Fill in each... -
AAV Purification by Iodixanol Gradient Ultracentrifugation
TypeProtocol...down. Option #2 Puncture the QuickSeal tube at the bottom using an 18 ga needle. Immediately start collecting...times to mix the iodixanol that has settled at the bottom of the column. We recommend concentrating to a ...volume with formulation buffer. Use a P1000 to the bottom of the filter and pipette up/down and wash off ... -
Handling Plasmids from Addgene - Purifying Plasmid DNA
TypeProtocol... protocol for kit-free plasmid mini-prep at the bottom of this page. Last Update: Feb. 8, 2018 Equipment...centrifuge tube, aliquot it into several tubes/bottles. Remove the supernatant and resuspend the bacteria...appear, consisting of precipitated protein particles Bottom phase - Organic phase (protein) Pipet the aqueous... -
Antibody Validation Using the Indirect ELISA Method
TypeProtocol... Pipettes, 10 mL, VWR 89130-898 1 L polystyrene bottle, Corning 430518 PBS, 1X pH 7.4, VWR 45000-446 TMB... mL of Tween-20 to into 999.5 mL 1X PBS Cap the bottle and invert several times to mix. Carefully remove... 15 minutes. Absorbance was read at 450 nm and plotted against the micrograms of antigen loaded. Last ... -
Isolating a Monoclonal Cell Population by Limiting Dilution
TypeProtocol...stable alternative, such as glutaGRO) To a 500 mL bottle of DMEM high glucose, add 55 mL of heat-inactivated...other phenotypes. For example, perform Western blotting to screen for lines with the highest or lowest...under blasticidin selection. Anti-Cas9 Western blotting was performed on whole-cell extracts from the ... -
AAV ddPCR Titration
TypeProtocol...to each PCR tube. Be careful to dispense to the bottom of the tube without collecting drops along the ..., load 70 µL of droplet generation oil into the bottom row of wells. Cover the cartridge with the DG8 ...disrupted insert the pipette tips and gently touch the bottom of the well. Lift the tips ~1 mm. Touch the side... -
Lentivirus ddPCR Titration
TypeProtocol...to each PCR tube. Be careful to dispense to the bottom of the tube without collecting drops along the ..., load 70 µL of droplet generation oil into the bottom row of wells. Cover the cartridge with the DG8 ...disrupted, insert the pipette tips and gently touch the bottom of the well. Lift the tips ~1mm. Touch the side... -
Protocol - Bacterial Transformation
TypeProtocol...microcentrifuge or falcon tube. GENTLY mix by flicking the bottom of the tube with your finger a few times. Pro-Tip...Heat shock each transformation tube by placing the bottom 1/2 to 2/3 of the tube into a 42°C water bath for... -
Protocol - How to Run an Agarose Gel
TypeProtocol...density of your DNA sample causing it settle to the bottom of the gel well, instead of diffusing in the buffer...will reach a point where the DNA will be in the bottom portion of the gel, but all of the EtBr will be... -
Protocol - How to Streak a Plate
TypeProtocol...agar plate with appropriate antibiotic. Label the bottom of the plate with the plasmid name and the date... -
Protocol - How to Purify DNA from an Agarose Gel
TypeProtocol...band, lay it down on the UV box and trim the top, bottom and sides with the razor blade. This is especially...